ID: 908859339

View in Genome Browser
Species Human (GRCh38)
Location 1:68465423-68465445
Sequence GAGCAAACTGTTCTGTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908859337_908859339 -10 Left 908859337 1:68465410-68465432 CCACGGGAGAGGGGAGCAAACTG No data
Right 908859339 1:68465423-68465445 GAGCAAACTGTTCTGTTCATGGG No data
908859336_908859339 -9 Left 908859336 1:68465409-68465431 CCCACGGGAGAGGGGAGCAAACT No data
Right 908859339 1:68465423-68465445 GAGCAAACTGTTCTGTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908859339 Original CRISPR GAGCAAACTGTTCTGTTCAT GGG Intergenic
No off target data available for this crispr