ID: 908860021

View in Genome Browser
Species Human (GRCh38)
Location 1:68473997-68474019
Sequence CCACCCTTTTATTTTGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908860021_908860024 6 Left 908860021 1:68473997-68474019 CCACTTTCAAAATAAAAGGGTGG 0: 1
1: 0
2: 3
3: 32
4: 262
Right 908860024 1:68474026-68474048 TCTTGGTCGTACAGATTACCAGG 0: 1
1: 0
2: 0
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908860021 Original CRISPR CCACCCTTTTATTTTGAAAG TGG (reversed) Intergenic
902893980 1:19466090-19466112 CAACCCTTTTATTGGGACAGAGG + Intronic
903695782 1:25205788-25205810 ACACCCTTTTACTTTGTGAGAGG - Intergenic
907191604 1:52653742-52653764 CCGCCCTTTTTTTTTGAGACAGG + Intronic
908750157 1:67414360-67414382 CCAACCTTTTTTTTTTAAGGTGG - Intronic
908860021 1:68473997-68474019 CCACCCTTTTATTTTGAAAGTGG - Intergenic
909618414 1:77639246-77639268 CCTCCCTTTTTTTTTCAATGGGG - Intronic
909961601 1:81852240-81852262 CCAAACTTTCATTTTTAAAGTGG - Intronic
910316844 1:85895452-85895474 ACACCATTTTATTTTGAAATGGG + Intronic
914247702 1:145898047-145898069 CCTCCCTTTTCTCTTGAAGGAGG + Intronic
914950950 1:152112973-152112995 CCTCCTATTTATTTTCAAAGTGG - Exonic
915610707 1:156989747-156989769 CCAACATTTTATTTTGAAAAAGG + Intronic
916997710 1:170318723-170318745 CCTCCCTTTTATTTTTAAAGGGG - Intergenic
917026203 1:170645235-170645257 CCACCATTTTATTTTGATACAGG - Intergenic
917310911 1:173677199-173677221 CAAAACTTTTATTTTGAGAGAGG + Intergenic
917481252 1:175414112-175414134 CCTCTCTTTTATTTTGAGATAGG - Intronic
918350194 1:183647448-183647470 TCTCTCCTTTATTTTGAAAGTGG - Exonic
918483917 1:185009336-185009358 CTTCCCTTTTACTTTTAAAGAGG - Intergenic
919204147 1:194398265-194398287 CCATGCTTCTATTTTGAAACAGG + Intergenic
919801291 1:201356195-201356217 CCACCCTTGCCTTTTGAAATTGG + Intergenic
921624703 1:217366090-217366112 CTAACCTTTTATTTTTAAAATGG - Intergenic
924733911 1:246737595-246737617 CCCCCCTTTTTTTTTGATACAGG + Intronic
1062997145 10:1877171-1877193 GCAGCCCTTTATTTTGAAAGTGG - Intergenic
1063978509 10:11435706-11435728 CCAGCCTTTTATTATGCAGGCGG + Intergenic
1064404297 10:15047390-15047412 CTCCCTTTTTAGTTTGAAAGAGG + Intronic
1064860946 10:19824823-19824845 CCACCTTTTTAATTAAAAAGAGG - Intronic
1065223377 10:23518609-23518631 CCACCTTTTTTTTTTGAGATAGG + Intergenic
1068048632 10:51919671-51919693 CCCACCTTTTTTTTTTAAAGTGG + Intronic
1069312538 10:67056101-67056123 CTACCCTTTTATTTTCTCAGAGG - Intronic
1070406384 10:76101119-76101141 CCAGCTTTTTATATTCAAAGAGG + Intronic
1071044249 10:81354579-81354601 CCCCCCTTTTTTTTTGAGACAGG + Intergenic
1071141577 10:82515756-82515778 CCACCATACCATTTTGAAAGTGG + Intronic
1071196328 10:83164577-83164599 ACACACATTTACTTTGAAAGAGG + Intergenic
1072153222 10:92699962-92699984 ACTCCCTTTTATTTTGGAGGGGG + Intergenic
1074897262 10:117787846-117787868 CCCGCCTTTTTTTTTGATAGAGG - Intergenic
1076052237 10:127344863-127344885 CTTCTCTTTTTTTTTGAAAGGGG - Intronic
1076259582 10:129054861-129054883 CCTCCCTTTTCTGTAGAAAGAGG - Intergenic
1076538818 10:131200548-131200570 CCACCATTGTATTTTGGAATCGG + Intronic
1077362762 11:2147982-2148004 CCTCCCTTATACTTTGAAAGAGG - Intronic
1080559759 11:33452257-33452279 ACACCCTTCTATTTTGCATGGGG - Intergenic
1080760284 11:35242213-35242235 CCTCACTTTTAATTTGAAATAGG + Intergenic
1081391877 11:42539188-42539210 CCACCCTTTTACTTGGCATGTGG - Intergenic
1081681569 11:45009238-45009260 CCACTCTTTTTTTTTTAAGGTGG + Intergenic
1083786172 11:64948959-64948981 CTACCCTTTTGATTTGAAAAGGG - Intronic
1085446907 11:76606795-76606817 CCACGTTTTGCTTTTGAAAGGGG - Intergenic
1085853380 11:80148026-80148048 CCACCCTTTGTTTTTGACAGTGG - Intergenic
1086969309 11:93063768-93063790 CCATCCTGTTATTTAGACAGAGG + Intergenic
1089414673 11:118277583-118277605 CCACCCTTAGCTTTGGAAAGGGG + Intergenic
1090294224 11:125572236-125572258 CCACCCTTTCATTTTTACAAGGG - Intronic
1092199604 12:6572120-6572142 CCACCTTTTTTTTTTGGAGGTGG - Intronic
1094622568 12:32094217-32094239 CCACCTTTTTTTTTTGAGACAGG + Intergenic
1095148649 12:38763313-38763335 CCACCATTTTCTTATGAAAGAGG + Intronic
1096646924 12:53043870-53043892 CCACACTTTTTTTTTGAGACAGG - Intergenic
1096914892 12:55020609-55020631 CCACTCTTTCATTTTGTTAGTGG + Intronic
1097750197 12:63344177-63344199 TCAAGCTTTTATTTTGAAATTGG + Intergenic
1097751971 12:63365579-63365601 CCATCATTATATTTTGGAAGTGG - Intergenic
1098010797 12:66049041-66049063 CTACCATTTTTTTTTGGAAGAGG - Intergenic
1098061525 12:66568369-66568391 CCACCATTTTTTCTTGAAAGAGG - Intronic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1099805798 12:87517578-87517600 CCACCATTGTATCTTGAAAATGG - Intergenic
1099925871 12:89016312-89016334 CCACATTTTTATTTTAAAATCGG + Intergenic
1101216596 12:102592085-102592107 CTATCCTTTGATTTTGAAGGAGG - Intergenic
1102188109 12:110965410-110965432 CCCCCCTTTTTTTTTGAGATAGG + Intergenic
1105911676 13:24874324-24874346 TAACCCTTTTCTTTTAAAAGAGG - Intronic
1106067914 13:26375445-26375467 ACACCCTTTTATATTGCAAATGG + Intronic
1106313298 13:28572428-28572450 CCTCCTTTTTGTTTTGAAACAGG - Intergenic
1107509896 13:41073211-41073233 CCACAGTTTTATTTTTAAAAAGG - Intronic
1107652495 13:42559479-42559501 CTATCCTTTTATTTTGCAGGGGG + Intergenic
1107919063 13:45184392-45184414 CCGCCCTTTTTTTTTGAGACAGG + Intronic
1108873760 13:55019103-55019125 CCACCGTTGTATTTTGAAGTAGG + Intergenic
1109141744 13:58720939-58720961 GAGCCATTTTATTTTGAAAGTGG + Intergenic
1109745580 13:66619172-66619194 CTACCATTTTATTTTAAAAGGGG - Intronic
1110156897 13:72327675-72327697 CCTCCCTTTTATTCTAAAAATGG - Intergenic
1111460974 13:88540923-88540945 ACACCATTTTATCTTGAAAGTGG + Intergenic
1112984403 13:105429968-105429990 CTCCCTTTTTATTTTGAGAGGGG - Intergenic
1113323857 13:109264953-109264975 CCAGCCTTTTATTATGGAGGCGG - Intergenic
1115220882 14:31057312-31057334 CCATCCTTTTGTTTTGAACCTGG + Intronic
1115733310 14:36295924-36295946 CCACCCCTTTATTTTAGAATTGG + Intergenic
1115863555 14:37716468-37716490 TAACCCTTTTATTTTCAAACTGG - Intronic
1118198550 14:63650840-63650862 TCACTCTTTTAGCTTGAAAGTGG - Intergenic
1120408451 14:84118992-84119014 ACATCTTTTTATTTTGGAAGAGG - Intergenic
1120985243 14:90329177-90329199 TTATCCTTTTATTTTGAGAGGGG - Intronic
1126219931 15:46201186-46201208 TCACCCATTTTTTTTTAAAGAGG - Intergenic
1126556160 15:49989718-49989740 CCACCATTTTGTTTTGACTGGGG - Intronic
1128778843 15:70344695-70344717 CAACACTTTTATTTTTAAAGTGG - Intergenic
1131523954 15:93137890-93137912 CCACCGTTTTTTTTTGGCAGAGG + Intergenic
1132004283 15:98212721-98212743 CCAACATTTTGTTTTGAAAGTGG + Intergenic
1132436314 15:101807127-101807149 CTACACTTTTTTTTTTAAAGAGG + Intronic
1135157431 16:20064858-20064880 CCACCATTTTGTTTTGGAACAGG - Intronic
1136574502 16:31115534-31115556 CCCCCCTTTTTTTTTGAGACAGG + Intergenic
1136997364 16:35199732-35199754 CCACCCTTTTATTATGCAGGCGG - Intergenic
1137010101 16:35312986-35313008 CCAACCTTTTATTATGCAGGCGG - Intergenic
1137331252 16:47498895-47498917 CTACCCTTTTGTTTTGAGACAGG - Intronic
1137613785 16:49835436-49835458 CCTCCCTTTTATTTTGCACCAGG - Intronic
1138176751 16:54906973-54906995 CCCCACTTTTTTTTTGAGAGAGG - Intergenic
1142387319 16:89774070-89774092 CTTCCTTTTTATATTGAAAGTGG - Intronic
1143045521 17:4075808-4075830 CTACCCTTTTCTTTTGAGCGGGG + Intronic
1143918809 17:10314625-10314647 CCACCTTTTTCTTCTGAAAAAGG - Intronic
1144857428 17:18277472-18277494 CTACCCTTTAATTTGGAATGAGG + Intronic
1145404669 17:22576530-22576552 CAAACTTTTTATATTGAAAGTGG + Intergenic
1145867485 17:28250389-28250411 CAACCCTTTTATATTGAGAGGGG - Intergenic
1146166796 17:30595937-30595959 TCTCCCATTTCTTTTGAAAGAGG + Intergenic
1146749574 17:35366099-35366121 CTACCTTTTTAATTTGAAGGAGG - Intronic
1147362296 17:39938688-39938710 CCAGCCTTTTTTTTTGAGAGAGG - Intergenic
1147454672 17:40529780-40529802 CCCCCCTTTTTTTTTGAGATTGG + Intergenic
1147993197 17:44347649-44347671 CCACACCTTTATTTTAAAGGAGG - Intronic
1148544517 17:48507250-48507272 TCCCTCTTTTTTTTTGAAAGAGG + Intergenic
1150366567 17:64592036-64592058 GCACCCATTTATTTTGCAAAGGG - Intronic
1150792635 17:68210941-68210963 CCCCCCTTTTTTTTTGAGACAGG - Intergenic
1152015907 17:77750020-77750042 AGCCCCTTTTAATTTGAAAGGGG - Intergenic
1152513582 17:80807344-80807366 CCACCCTTTTTTTTGGAGCGGGG + Intronic
1153607244 18:6846830-6846852 CCACCCTTGGATTATGAGAGTGG + Intronic
1155943390 18:31822060-31822082 CCAACCTTTTATTATGTAGGCGG - Intergenic
1155974298 18:32111340-32111362 TCATCCTTTTATTTTGTAAGGGG + Intronic
1157732498 18:50016373-50016395 CTACCTTTTTATTTTAAAAGGGG - Intronic
1159869950 18:73750013-73750035 TCACTCTTTTATTTTGAGAACGG + Intergenic
1161757040 19:6141737-6141759 CCACCCTTTTGTTTTGAGACAGG + Intronic
1162463443 19:10826879-10826901 AGACACTTTTTTTTTGAAAGAGG - Intronic
1163133327 19:15290516-15290538 GCACCCATTTATTATTAAAGGGG - Intronic
1165024345 19:32948729-32948751 CCACCCCTTTTTTTTGAGACAGG + Intronic
1166063485 19:40342312-40342334 CCAGCCTTTTTTTTTGAGACAGG - Intronic
1167022197 19:46885744-46885766 CCACCTTTTTATTTTTAGTGAGG + Intergenic
928100779 2:28436372-28436394 CCAGCCTTTAATTTAGACAGAGG + Intergenic
928785478 2:34880536-34880558 ATACCTTTTTATTTTAAAAGCGG - Intergenic
930682826 2:54275441-54275463 ACAGTCTTTAATTTTGAAAGAGG + Intronic
931413533 2:62058730-62058752 CCACCTTTTTTTTTTGAGACAGG - Intronic
931509257 2:62972169-62972191 CCACTGTCTTTTTTTGAAAGAGG + Intronic
936673099 2:114682645-114682667 CCAGGCTTTCACTTTGAAAGTGG - Intronic
938623902 2:133087615-133087637 CTAGCCATTTATTTTGACAGTGG + Intronic
939635510 2:144577214-144577236 TTACCCTTTTACTTTGATAGAGG + Intergenic
941108256 2:161387381-161387403 CATGCCTTTTATTTTGAAGGGGG + Intronic
942950501 2:181715753-181715775 ACAACCTTTTATTTTTAAAATGG - Intergenic
943731148 2:191305181-191305203 CCACCCTTTGTTGTTGAAATTGG + Intronic
945405760 2:209446861-209446883 CCACTCTTTAATTTTGAACTTGG - Intronic
945407426 2:209466827-209466849 TAGCTCTTTTATTTTGAAAGTGG - Intronic
945446801 2:209948411-209948433 CAAACCTTTTAATTTGAAAGAGG - Intronic
945577632 2:211552018-211552040 CCACGTTTTTAATGTGAAAGAGG + Intronic
946572210 2:221036528-221036550 TCTGCCTTTTATTTTCAAAGGGG - Intergenic
947344159 2:229173645-229173667 CTGGCCTTTTATTTTGAAACAGG - Intronic
948263473 2:236621299-236621321 CCTCTCTCTTCTTTTGAAAGAGG - Intergenic
948707713 2:239805309-239805331 CTACCCATTTATTCTGAAAGGGG - Intergenic
1169771660 20:9207862-9207884 CCTGTGTTTTATTTTGAAAGAGG - Intronic
1171303674 20:24086037-24086059 CCAGCTTTTTTTTTTTAAAGAGG + Intergenic
1172568493 20:35950784-35950806 CCAGCCTTTTATTTAGAGACAGG - Intergenic
1173705116 20:45104409-45104431 CAACCCTGTGAATTTGAAAGTGG + Intergenic
1174811895 20:53653184-53653206 CCACCATTCTATTTTGCAGGAGG + Intergenic
1175878534 20:62243173-62243195 CTACCCTCTTACTGTGAAAGAGG + Intronic
1177564522 21:22801547-22801569 TCTCCCCTTTATTTTCAAAGGGG + Intergenic
1178804741 21:35829555-35829577 CAACCCTTTTATCTTTAAACTGG - Intronic
1180685290 22:17661389-17661411 CCAACATTTTATTTTTTAAGTGG + Intronic
1181504889 22:23346807-23346829 GCACCTTTTTTTTTTGAAACAGG - Intergenic
950393634 3:12716677-12716699 CCAAGCTTTTATTTTGAAATGGG - Intergenic
952001940 3:28796157-28796179 GCACACATTTATTGTGAAAGTGG - Intergenic
952740002 3:36725609-36725631 CCCCTCTTTTATTTTGAGACAGG - Intronic
953039998 3:39247936-39247958 CCAACTTTTTATTTTAAAAATGG - Intergenic
953661614 3:44894992-44895014 CCACCCCTTGATTTTCTAAGAGG - Intronic
954079234 3:48203309-48203331 CCTGCCTTTTATTAAGAAAGGGG - Intergenic
955116136 3:56004831-56004853 GTACCCTTTTATTTAAAAAGAGG + Intronic
956527637 3:70182220-70182242 CCACCCCTTTCTTTCGAAGGTGG - Intergenic
957257466 3:77856640-77856662 CCAGCTTTTTATTTTTAAAGCGG - Intergenic
957996160 3:87692454-87692476 CCAATCTTTTATTTTGCAGGTGG - Intergenic
959514603 3:107250874-107250896 CCCCCTTTTTTTTTTGACAGAGG + Intergenic
959943359 3:112102622-112102644 CAAACTTTTTATTTTGATAGAGG + Intronic
961426576 3:126852961-126852983 CCACCTTTTTTTGTTGAATGTGG + Intronic
962070470 3:132028554-132028576 TCACCATTTTATTTTTAAATGGG - Intronic
965441924 3:168724933-168724955 CCAACTTTTTATTTTCCAAGAGG - Intergenic
965625597 3:170681621-170681643 CCTCCTTTTTTTTTTGAAATGGG + Intronic
965909130 3:173749573-173749595 CTGACCTTTTATTTTGGAAGGGG - Intronic
967545723 3:190724921-190724943 CCACCTTTTTATTTTTAAAATGG - Intergenic
967608210 3:191473370-191473392 GTAGCTTTTTATTTTGAAAGTGG + Intergenic
967667776 3:192194414-192194436 CCACAGTTTCATTTTGTAAGTGG - Intronic
969252270 4:5975846-5975868 ACTCTCTTTTGTTTTGAAAGAGG + Intronic
969802721 4:9582026-9582048 CCAACCTTTTATTTTGTGGGGGG - Intergenic
972277293 4:37569089-37569111 CCCCCCTTTTTTTTTGAGACAGG - Intronic
972719516 4:41682085-41682107 TGACTGTTTTATTTTGAAAGAGG + Intronic
975034952 4:69668690-69668712 CCTGCCTTTAACTTTGAAAGAGG + Intergenic
975296675 4:72742990-72743012 GGACCCTTTTAGTTTGACAGAGG + Intergenic
975845679 4:78522899-78522921 CTAGACTTTTATTTTAAAAGGGG + Intronic
976570053 4:86596812-86596834 TCACCCTCTTCTTTTGACAGAGG + Intronic
976575345 4:86663520-86663542 CCACCCTTTTCCTCTGAAATAGG - Intronic
977210523 4:94212775-94212797 CCACACCTTTATTTTAAAATAGG + Intronic
977313863 4:95420445-95420467 ACACTCTTTTATTTTTAAAAGGG + Intronic
978532885 4:109731768-109731790 CGACTCTTTTATTGTAAAAGAGG - Intergenic
978740122 4:112127523-112127545 TCATCCTTTTTTTTTTAAAGTGG - Intergenic
981436127 4:144724250-144724272 GCACCTATTTATTTTGAAATAGG - Intronic
981548157 4:145915843-145915865 CCACTATTGTATTTTGGAAGTGG - Intronic
981947632 4:150366945-150366967 CTTCCCATTCATTTTGAAAGGGG + Intronic
981959808 4:150522981-150523003 CCACAGTTGTATTTTGAAGGCGG + Intronic
982034434 4:151331771-151331793 CCACCCATTTACATTAAAAGTGG - Intergenic
982719537 4:158845700-158845722 CCACCCTTTTGTCATGAAAATGG + Intronic
982955454 4:161759901-161759923 CCACTGTTTTATTTTGACATAGG - Intronic
988589095 5:32533525-32533547 CCAACCTTTTTTTTTAAAGGAGG - Intronic
989019332 5:36983384-36983406 CCACTGTTTTCTTTTTAAAGTGG - Intronic
989546022 5:42674380-42674402 CCACCTTTTTAATCTCAAAGTGG + Intronic
989706224 5:44334181-44334203 CCATTTTTTTATTTTGAATGAGG + Intronic
991000964 5:61782603-61782625 GCACCATTTTAATTTGAAACAGG - Intergenic
991520583 5:67492947-67492969 ACACCCTCTTATTGTGAAATTGG + Intergenic
992071396 5:73152459-73152481 CCACCCTTCTATTCTGAGATGGG + Intergenic
993363751 5:87009666-87009688 CTACACTTTTATTTTGAACTGGG + Intergenic
993563160 5:89437728-89437750 CCATCCTTTTCTTTAGAAACAGG - Intergenic
993742020 5:91553354-91553376 CCACCATTGTATTTTGGAAGTGG + Intergenic
994018421 5:94995451-94995473 CTCTCCTTTTATTTTTAAAGTGG - Intronic
995148791 5:108818039-108818061 CCTCCTTTTTATTATGAAATAGG + Intronic
995878512 5:116817825-116817847 TCATCCTTTTATTATGAGAGAGG + Intergenic
996563895 5:124859446-124859468 CCAGCTCTTTATTTGGAAAGGGG + Intergenic
997163239 5:131631773-131631795 CTACCTTTTTGTTTTTAAAGAGG - Intronic
999081875 5:148852235-148852257 CCACTCTTTTAATTTCAAAGAGG + Intergenic
1000168507 5:158678631-158678653 ACTCCTATTTATTTTGAAAGCGG + Intergenic
1001124664 5:169008535-169008557 CCACCTTTCTATTGAGAAAGAGG + Intronic
1001380415 5:171302589-171302611 CCACTTTTGCATTTTGAAAGGGG - Intergenic
1002900096 6:1404118-1404140 GCAACCTTTTAATTTAAAAGAGG - Intergenic
1003473592 6:6461050-6461072 CCACCCTCTTTTTATGTAAGTGG + Intergenic
1003742512 6:8958757-8958779 CAACCCTTTCAGTTTGAAAAAGG + Intergenic
1005164485 6:22903673-22903695 CCATCCTTTTAAATGGAAAGAGG + Intergenic
1005589197 6:27307507-27307529 TTACCCTCTTATTTTGAAATAGG + Intronic
1006526415 6:34609482-34609504 CCACCTTTTTTTTTTGAGATAGG - Intronic
1006580519 6:35074562-35074584 CCAGACTTTTTTTTTAAAAGTGG - Intronic
1007491507 6:42226584-42226606 CCATCATTCTATTTTCAAAGAGG - Exonic
1008194148 6:48497676-48497698 CCACCCTTTTCTTTTTAATTAGG + Intergenic
1008329840 6:50231754-50231776 TAACCGATTTATTTTGAAAGGGG + Intergenic
1009382014 6:63043404-63043426 CCATCCCTTTATTTTGAGATGGG + Intergenic
1010062951 6:71646040-71646062 CCACCATTGTATTTTAGAAGTGG - Intergenic
1011212805 6:84972304-84972326 GCCCACTTTTATTTTGAAACAGG + Intergenic
1011563544 6:88648633-88648655 CCATCCTTTTATTTCTACAGAGG + Intronic
1011579607 6:88845517-88845539 CTACTCTTTTATTTTGCAACTGG + Intronic
1012000629 6:93650344-93650366 CCACCTTTATATTTACAAAGGGG + Intergenic
1012177938 6:96112459-96112481 TCACCCTTATATTTTGATATTGG - Intronic
1013060473 6:106629288-106629310 CCCCCCTTTTTTTTTTAAAGTGG - Exonic
1013776558 6:113684913-113684935 CAACTCTTTTGTTTTAAAAGAGG + Intergenic
1014904052 6:127004765-127004787 GTAACCTTTTATGTTGAAAGTGG + Intergenic
1015315812 6:131814952-131814974 CCACACTTTGATTTGGAAAAGGG + Intronic
1015490230 6:133816940-133816962 GCACCCTTCTATTTTTAAAAAGG - Intergenic
1020224323 7:6268107-6268129 CCATTCTTGTGTTTTGAAAGAGG - Intronic
1020241679 7:6399965-6399987 CCACCCTTTCAGTTTGTCAGAGG - Intronic
1020559576 7:9713891-9713913 AAACTCTTTTATTTTGGAAGGGG + Intergenic
1022751468 7:33231173-33231195 TCACCCTTTTTTTTTGAGATGGG + Intronic
1022845580 7:34206559-34206581 CCGTCCTTTTATTTTTAGAGAGG - Intergenic
1023244509 7:38186925-38186947 CCAACCTTTTATTCTCACAGTGG - Intronic
1023329277 7:39097505-39097527 CCTCTCCTTTGTTTTGAAAGTGG - Intronic
1024029151 7:45442154-45442176 CCACATTTTTATTTTGCATGGGG + Intergenic
1024913361 7:54470887-54470909 CCACTCTGTTATTTTGGATGAGG - Intergenic
1025994539 7:66519575-66519597 CCACTCTTTTTTTTTGAGACAGG - Intergenic
1026030853 7:66792580-66792602 CTACCCTTTTCTCTTGAAGGAGG + Intronic
1028076822 7:86526642-86526664 CCACACATTTATTTTCAAAAAGG + Intergenic
1028667207 7:93360359-93360381 CCACCATTTCATTTTGAAGATGG - Intronic
1028983673 7:96993478-96993500 ACACTTTTTTATTTTTAAAGTGG - Intergenic
1029300814 7:99580966-99580988 CCACCTTTTTTTTTTGAGACAGG + Intronic
1029353107 7:100029615-100029637 CAACCCTTTTATTTTAAAGAAGG - Intronic
1030876628 7:114820960-114820982 GAACCCTTTTATTTGGGAAGAGG + Intergenic
1032996660 7:137454682-137454704 TCACCCTTTTTTTTAGAAAGTGG - Intronic
1033457780 7:141518088-141518110 CGATACTTTTATTTTGTAAGTGG - Intergenic
1035907747 8:3531948-3531970 CCAGTCTTTTATTTTGCAGGTGG - Intronic
1036442619 8:8794742-8794764 GAATCATTTTATTTTGAAAGAGG - Intronic
1036576746 8:10034486-10034508 CCCCCCTTTTTTTTTGAGACAGG - Intergenic
1036586819 8:10132220-10132242 CCAAACTTTTTTTGTGAAAGGGG - Intronic
1038003751 8:23412568-23412590 CAAACTTTTCATTTTGAAAGAGG - Intronic
1039744585 8:40412897-40412919 CCACCCAGTTATTTTCAAAATGG + Intergenic
1039754939 8:40512901-40512923 CCACAACTGTATTTTGAAAGAGG + Intergenic
1040897746 8:52386661-52386683 CTTTCCTTTTATTTTAAAAGGGG + Intronic
1041086677 8:54263024-54263046 CCACCCTTTTTTTTTGAGACAGG + Intergenic
1041185517 8:55296380-55296402 CTACCCTTTTCTTTTAATAGTGG - Intronic
1041441489 8:57901640-57901662 TTACCCTTTTATTTTCAATGTGG - Intergenic
1041826367 8:62100009-62100031 CCAATCTTTTATTATGCAAGTGG + Intergenic
1042472769 8:69210255-69210277 AAACCCTTTTATTCTGGAAGGGG - Intergenic
1043622572 8:82213711-82213733 ACACCCATTTATTTTCAAAAAGG + Intergenic
1046551047 8:115717364-115717386 CCAACATTTTATTTTGCCAGTGG + Intronic
1046858906 8:119068109-119068131 TCACCCTTTTGTTCTGAAAGTGG + Intronic
1046971504 8:120228412-120228434 CCACCCAATTACTTTGAAATAGG - Intronic
1047348681 8:124052933-124052955 CGACACTTTTATTTTTAAAAAGG - Intronic
1047387965 8:124426921-124426943 CTCCTCTTTTTTTTTGAAAGAGG - Intergenic
1051754445 9:20382380-20382402 ACACCGTTTTCTTTTGAAAGAGG - Intronic
1056377258 9:86026529-86026551 CAACCCTCTTATTTTCAGAGGGG - Exonic
1056920697 9:90785904-90785926 TCACGCTTCTATTTTGAGAGTGG - Intergenic
1057967075 9:99514633-99514655 CTACCCTTTGATTTTTTAAGAGG + Intergenic
1058001802 9:99873391-99873413 CCATCCTTTTATCTGGAACGTGG + Intergenic
1059918138 9:119126806-119126828 CCTCACTTTTTTTTTTAAAGAGG + Intergenic
1187149620 X:16669643-16669665 CCAGTCTTCTATTTTGAAAATGG + Intronic
1187217945 X:17295332-17295354 GCAGCCATTTCTTTTGAAAGTGG - Intergenic
1188635830 X:32429752-32429774 AAGCCCTTTTATTTAGAAAGAGG - Intronic
1189608197 X:42702663-42702685 CCATACATATATTTTGAAAGAGG - Intergenic
1191682782 X:63858202-63858224 CCACCCTCTTTTTTTGAGACAGG - Intergenic
1191736184 X:64390655-64390677 TCACCCTTTTTTTTTGAAACAGG + Intronic
1191815172 X:65236082-65236104 ACACCATTTTATTTTGTAAAAGG + Intergenic
1192319393 X:70077314-70077336 CCACCCTCTTAAGTTGAAAGGGG + Intergenic
1192974134 X:76265613-76265635 CCATCCCTTTATTTTGATTGGGG + Intergenic
1192986229 X:76401455-76401477 CCAGCCTTCTATTGTGAAAAAGG - Intergenic
1193063434 X:77231602-77231624 CTAACTTTTTATTTTGAAACAGG - Intergenic
1193764254 X:85506908-85506930 CCAACATTTTATTCTGATAGAGG + Intergenic
1194692165 X:97000304-97000326 CCAGGCCTTTACTTTGAAAGTGG - Intronic
1194860170 X:98989994-98990016 ACAAGCTTGTATTTTGAAAGAGG + Intergenic
1197362576 X:125524321-125524343 CTTCACTTTTATTTTCAAAGTGG + Intergenic
1197712452 X:129681303-129681325 CCTCTATTTTGTTTTGAAAGTGG + Intergenic
1199371808 X:147058105-147058127 CCACCATTGTATTTTGAAAGTGG + Intergenic
1199502547 X:148523935-148523957 CCACCCTTGTATTTTCAAAGTGG + Intronic
1199924278 X:152446236-152446258 CCACACCTTTCTTTTTAAAGCGG + Intronic
1200787469 Y:7273444-7273466 CCACATTTTTACTTGGAAAGGGG - Intergenic
1202257184 Y:22933685-22933707 GCTCCCTTTTGCTTTGAAAGTGG - Intergenic
1202410175 Y:24567433-24567455 GCTCCCTTTTGCTTTGAAAGTGG - Intergenic
1202460607 Y:25102639-25102661 GCTCCCTTTTGCTTTGAAAGTGG + Intergenic