ID: 908867433

View in Genome Browser
Species Human (GRCh38)
Location 1:68566114-68566136
Sequence GGTAGATTCCGCATCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908867428_908867433 5 Left 908867428 1:68566086-68566108 CCCAGGGGGTTATCTGGATGTGG No data
Right 908867433 1:68566114-68566136 GGTAGATTCCGCATCCACAGTGG No data
908867430_908867433 4 Left 908867430 1:68566087-68566109 CCAGGGGGTTATCTGGATGTGGA No data
Right 908867433 1:68566114-68566136 GGTAGATTCCGCATCCACAGTGG No data
908867427_908867433 6 Left 908867427 1:68566085-68566107 CCCCAGGGGGTTATCTGGATGTG No data
Right 908867433 1:68566114-68566136 GGTAGATTCCGCATCCACAGTGG No data
908867422_908867433 21 Left 908867422 1:68566070-68566092 CCTTTTCTTTCAAGTCCCCAGGG No data
Right 908867433 1:68566114-68566136 GGTAGATTCCGCATCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908867433 Original CRISPR GGTAGATTCCGCATCCACAG TGG Intergenic
No off target data available for this crispr