ID: 908869421

View in Genome Browser
Species Human (GRCh38)
Location 1:68591687-68591709
Sequence CAATTGGATTTCTAAGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908869421_908869423 -3 Left 908869421 1:68591687-68591709 CCTCAGACTTAGAAATCCAATTG No data
Right 908869423 1:68591707-68591729 TTGCTGATGAGATGTTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908869421 Original CRISPR CAATTGGATTTCTAAGTCTG AGG (reversed) Intergenic
No off target data available for this crispr