ID: 908872945

View in Genome Browser
Species Human (GRCh38)
Location 1:68635363-68635385
Sequence CAGCCCAGTAACCTTGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908872942_908872945 5 Left 908872942 1:68635335-68635357 CCAATGACTGCCTGATGTGGGGG No data
Right 908872945 1:68635363-68635385 CAGCCCAGTAACCTTGCTGTTGG No data
908872936_908872945 22 Left 908872936 1:68635318-68635340 CCCTTAACTCCAGGCAGCCAATG No data
Right 908872945 1:68635363-68635385 CAGCCCAGTAACCTTGCTGTTGG No data
908872938_908872945 13 Left 908872938 1:68635327-68635349 CCAGGCAGCCAATGACTGCCTGA No data
Right 908872945 1:68635363-68635385 CAGCCCAGTAACCTTGCTGTTGG No data
908872944_908872945 -5 Left 908872944 1:68635345-68635367 CCTGATGTGGGGGTGTAACAGCC No data
Right 908872945 1:68635363-68635385 CAGCCCAGTAACCTTGCTGTTGG No data
908872937_908872945 21 Left 908872937 1:68635319-68635341 CCTTAACTCCAGGCAGCCAATGA No data
Right 908872945 1:68635363-68635385 CAGCCCAGTAACCTTGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908872945 Original CRISPR CAGCCCAGTAACCTTGCTGT TGG Intergenic
No off target data available for this crispr