ID: 908874088

View in Genome Browser
Species Human (GRCh38)
Location 1:68649717-68649739
Sequence CTGTGAAAGGGAAAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908874088_908874094 18 Left 908874088 1:68649717-68649739 CCATCCTTCTTTCCCTTTCACAG No data
Right 908874094 1:68649758-68649780 CCCATGTTATCAGCCAGTATTGG No data
908874088_908874096 21 Left 908874088 1:68649717-68649739 CCATCCTTCTTTCCCTTTCACAG No data
Right 908874096 1:68649761-68649783 ATGTTATCAGCCAGTATTGGTGG No data
908874088_908874097 22 Left 908874088 1:68649717-68649739 CCATCCTTCTTTCCCTTTCACAG No data
Right 908874097 1:68649762-68649784 TGTTATCAGCCAGTATTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908874088 Original CRISPR CTGTGAAAGGGAAAGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr