ID: 908877538

View in Genome Browser
Species Human (GRCh38)
Location 1:68695111-68695133
Sequence GTTTAAAAGATGAAATACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908877538_908877546 13 Left 908877538 1:68695111-68695133 CCTATGTATTTCATCTTTTAAAC No data
Right 908877546 1:68695147-68695169 GGAGGTTCATTCTTGGTGTTGGG No data
908877538_908877541 -5 Left 908877538 1:68695111-68695133 CCTATGTATTTCATCTTTTAAAC No data
Right 908877541 1:68695129-68695151 TAAACCACCTCAGGCACAGGAGG No data
908877538_908877544 6 Left 908877538 1:68695111-68695133 CCTATGTATTTCATCTTTTAAAC No data
Right 908877544 1:68695140-68695162 AGGCACAGGAGGTTCATTCTTGG No data
908877538_908877540 -8 Left 908877538 1:68695111-68695133 CCTATGTATTTCATCTTTTAAAC No data
Right 908877540 1:68695126-68695148 TTTTAAACCACCTCAGGCACAGG No data
908877538_908877545 12 Left 908877538 1:68695111-68695133 CCTATGTATTTCATCTTTTAAAC No data
Right 908877545 1:68695146-68695168 AGGAGGTTCATTCTTGGTGTTGG No data
908877538_908877547 29 Left 908877538 1:68695111-68695133 CCTATGTATTTCATCTTTTAAAC No data
Right 908877547 1:68695163-68695185 TGTTGGGCATTCTGAAAGACTGG No data
908877538_908877548 30 Left 908877538 1:68695111-68695133 CCTATGTATTTCATCTTTTAAAC No data
Right 908877548 1:68695164-68695186 GTTGGGCATTCTGAAAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908877538 Original CRISPR GTTTAAAAGATGAAATACAT AGG (reversed) Intergenic
No off target data available for this crispr