ID: 908877542

View in Genome Browser
Species Human (GRCh38)
Location 1:68695133-68695155
Sequence TGAACCTCCTGTGCCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908877542_908877548 8 Left 908877542 1:68695133-68695155 CCACCTCAGGCACAGGAGGTTCA No data
Right 908877548 1:68695164-68695186 GTTGGGCATTCTGAAAGACTGGG No data
908877542_908877546 -9 Left 908877542 1:68695133-68695155 CCACCTCAGGCACAGGAGGTTCA No data
Right 908877546 1:68695147-68695169 GGAGGTTCATTCTTGGTGTTGGG No data
908877542_908877547 7 Left 908877542 1:68695133-68695155 CCACCTCAGGCACAGGAGGTTCA No data
Right 908877547 1:68695163-68695185 TGTTGGGCATTCTGAAAGACTGG No data
908877542_908877545 -10 Left 908877542 1:68695133-68695155 CCACCTCAGGCACAGGAGGTTCA No data
Right 908877545 1:68695146-68695168 AGGAGGTTCATTCTTGGTGTTGG No data
908877542_908877549 17 Left 908877542 1:68695133-68695155 CCACCTCAGGCACAGGAGGTTCA No data
Right 908877549 1:68695173-68695195 TCTGAAAGACTGGGAGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908877542 Original CRISPR TGAACCTCCTGTGCCTGAGG TGG (reversed) Intergenic
No off target data available for this crispr