ID: 908877543

View in Genome Browser
Species Human (GRCh38)
Location 1:68695136-68695158
Sequence GAATGAACCTCCTGTGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908877543_908877548 5 Left 908877543 1:68695136-68695158 CCTCAGGCACAGGAGGTTCATTC No data
Right 908877548 1:68695164-68695186 GTTGGGCATTCTGAAAGACTGGG No data
908877543_908877549 14 Left 908877543 1:68695136-68695158 CCTCAGGCACAGGAGGTTCATTC No data
Right 908877549 1:68695173-68695195 TCTGAAAGACTGGGAGTCCAAGG No data
908877543_908877547 4 Left 908877543 1:68695136-68695158 CCTCAGGCACAGGAGGTTCATTC No data
Right 908877547 1:68695163-68695185 TGTTGGGCATTCTGAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908877543 Original CRISPR GAATGAACCTCCTGTGCCTG AGG (reversed) Intergenic
No off target data available for this crispr