ID: 908877546

View in Genome Browser
Species Human (GRCh38)
Location 1:68695147-68695169
Sequence GGAGGTTCATTCTTGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908877538_908877546 13 Left 908877538 1:68695111-68695133 CCTATGTATTTCATCTTTTAAAC No data
Right 908877546 1:68695147-68695169 GGAGGTTCATTCTTGGTGTTGGG No data
908877542_908877546 -9 Left 908877542 1:68695133-68695155 CCACCTCAGGCACAGGAGGTTCA No data
Right 908877546 1:68695147-68695169 GGAGGTTCATTCTTGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908877546 Original CRISPR GGAGGTTCATTCTTGGTGTT GGG Intergenic
No off target data available for this crispr