ID: 908877547

View in Genome Browser
Species Human (GRCh38)
Location 1:68695163-68695185
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908877542_908877547 7 Left 908877542 1:68695133-68695155 CCACCTCAGGCACAGGAGGTTCA No data
Right 908877547 1:68695163-68695185 TGTTGGGCATTCTGAAAGACTGG No data
908877538_908877547 29 Left 908877538 1:68695111-68695133 CCTATGTATTTCATCTTTTAAAC No data
Right 908877547 1:68695163-68695185 TGTTGGGCATTCTGAAAGACTGG No data
908877543_908877547 4 Left 908877543 1:68695136-68695158 CCTCAGGCACAGGAGGTTCATTC No data
Right 908877547 1:68695163-68695185 TGTTGGGCATTCTGAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type