ID: 908877549

View in Genome Browser
Species Human (GRCh38)
Location 1:68695173-68695195
Sequence TCTGAAAGACTGGGAGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908877543_908877549 14 Left 908877543 1:68695136-68695158 CCTCAGGCACAGGAGGTTCATTC No data
Right 908877549 1:68695173-68695195 TCTGAAAGACTGGGAGTCCAAGG No data
908877542_908877549 17 Left 908877542 1:68695133-68695155 CCACCTCAGGCACAGGAGGTTCA No data
Right 908877549 1:68695173-68695195 TCTGAAAGACTGGGAGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908877549 Original CRISPR TCTGAAAGACTGGGAGTCCA AGG Intergenic
No off target data available for this crispr