ID: 908878512

View in Genome Browser
Species Human (GRCh38)
Location 1:68704363-68704385
Sequence AAAGATTTGGGAAAGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908878507_908878512 23 Left 908878507 1:68704317-68704339 CCCTGGAGAGATAGGGGTTTAAT No data
Right 908878512 1:68704363-68704385 AAAGATTTGGGAAAGTCTGAGGG No data
908878508_908878512 22 Left 908878508 1:68704318-68704340 CCTGGAGAGATAGGGGTTTAATG No data
Right 908878512 1:68704363-68704385 AAAGATTTGGGAAAGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908878512 Original CRISPR AAAGATTTGGGAAAGTCTGA GGG Intergenic
No off target data available for this crispr