ID: 908890187

View in Genome Browser
Species Human (GRCh38)
Location 1:68837693-68837715
Sequence CTACAAAGGCAGATTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908890187_908890193 6 Left 908890187 1:68837693-68837715 CCAAGCTCAATCTGCCTTTGTAG No data
Right 908890193 1:68837722-68837744 ATGCACTTGGAATATTTATCTGG No data
908890187_908890192 -7 Left 908890187 1:68837693-68837715 CCAAGCTCAATCTGCCTTTGTAG No data
Right 908890192 1:68837709-68837731 TTTGTAGGGGAAGATGCACTTGG No data
908890187_908890194 7 Left 908890187 1:68837693-68837715 CCAAGCTCAATCTGCCTTTGTAG No data
Right 908890194 1:68837723-68837745 TGCACTTGGAATATTTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908890187 Original CRISPR CTACAAAGGCAGATTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr