ID: 908892025

View in Genome Browser
Species Human (GRCh38)
Location 1:68859286-68859308
Sequence GAAGAGGAGAGACTGACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908892025_908892030 23 Left 908892025 1:68859286-68859308 CCCAGAGTCAGTCTCTCCTCTTC No data
Right 908892030 1:68859332-68859354 TTCCTCCTGGCTCACAGTGTAGG No data
908892025_908892029 10 Left 908892025 1:68859286-68859308 CCCAGAGTCAGTCTCTCCTCTTC No data
Right 908892029 1:68859319-68859341 GAGACTCACAGTTTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908892025 Original CRISPR GAAGAGGAGAGACTGACTCT GGG (reversed) Intergenic
No off target data available for this crispr