ID: 908892029

View in Genome Browser
Species Human (GRCh38)
Location 1:68859319-68859341
Sequence GAGACTCACAGTTTTCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908892024_908892029 29 Left 908892024 1:68859267-68859289 CCTCAGTAGAAATGTGTATCCCA No data
Right 908892029 1:68859319-68859341 GAGACTCACAGTTTTCCTCCTGG No data
908892025_908892029 10 Left 908892025 1:68859286-68859308 CCCAGAGTCAGTCTCTCCTCTTC No data
Right 908892029 1:68859319-68859341 GAGACTCACAGTTTTCCTCCTGG No data
908892026_908892029 9 Left 908892026 1:68859287-68859309 CCAGAGTCAGTCTCTCCTCTTCT No data
Right 908892029 1:68859319-68859341 GAGACTCACAGTTTTCCTCCTGG No data
908892028_908892029 -6 Left 908892028 1:68859302-68859324 CCTCTTCTGATACTCTGGAGACT No data
Right 908892029 1:68859319-68859341 GAGACTCACAGTTTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908892029 Original CRISPR GAGACTCACAGTTTTCCTCC TGG Intergenic
No off target data available for this crispr