ID: 908892030

View in Genome Browser
Species Human (GRCh38)
Location 1:68859332-68859354
Sequence TTCCTCCTGGCTCACAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908892028_908892030 7 Left 908892028 1:68859302-68859324 CCTCTTCTGATACTCTGGAGACT No data
Right 908892030 1:68859332-68859354 TTCCTCCTGGCTCACAGTGTAGG No data
908892025_908892030 23 Left 908892025 1:68859286-68859308 CCCAGAGTCAGTCTCTCCTCTTC No data
Right 908892030 1:68859332-68859354 TTCCTCCTGGCTCACAGTGTAGG No data
908892026_908892030 22 Left 908892026 1:68859287-68859309 CCAGAGTCAGTCTCTCCTCTTCT No data
Right 908892030 1:68859332-68859354 TTCCTCCTGGCTCACAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908892030 Original CRISPR TTCCTCCTGGCTCACAGTGT AGG Intergenic
No off target data available for this crispr