ID: 908892679

View in Genome Browser
Species Human (GRCh38)
Location 1:68863845-68863867
Sequence CGGCCAACAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908892679_908892687 19 Left 908892679 1:68863845-68863867 CCGTCCACCACTGCTGTTGGCCG No data
Right 908892687 1:68863887-68863909 GACTTCCACCCCTCTGGATCCGG 0: 28
1: 72
2: 82
3: 94
4: 145
908892679_908892690 24 Left 908892679 1:68863845-68863867 CCGTCCACCACTGCTGTTGGCCG No data
Right 908892690 1:68863892-68863914 CCACCCCTCTGGATCCGGCTGGG No data
908892679_908892688 23 Left 908892679 1:68863845-68863867 CCGTCCACCACTGCTGTTGGCCG No data
Right 908892688 1:68863891-68863913 TCCACCCCTCTGGATCCGGCTGG 0: 12
1: 51
2: 119
3: 150
4: 212
908892679_908892685 13 Left 908892679 1:68863845-68863867 CCGTCCACCACTGCTGTTGGCCG No data
Right 908892685 1:68863881-68863903 GCCACTGACTTCCACCCCTCTGG 0: 20
1: 67
2: 87
3: 104
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908892679 Original CRISPR CGGCCAACAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr