ID: 908894503

View in Genome Browser
Species Human (GRCh38)
Location 1:68883167-68883189
Sequence CTGTTAACTGAGATGGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908894499_908894503 -6 Left 908894499 1:68883150-68883172 CCTTGGTGAATGGTTTTCTGTTA No data
Right 908894503 1:68883167-68883189 CTGTTAACTGAGATGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908894503 Original CRISPR CTGTTAACTGAGATGGGGAA TGG Intergenic
No off target data available for this crispr