ID: 908903659

View in Genome Browser
Species Human (GRCh38)
Location 1:68984062-68984084
Sequence TAAATCAGGATTGCTAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908903654_908903659 -2 Left 908903654 1:68984041-68984063 CCGGGCCACACCTAGACTAATTA No data
Right 908903659 1:68984062-68984084 TAAATCAGGATTGCTAAAGGTGG No data
908903653_908903659 -1 Left 908903653 1:68984040-68984062 CCCGGGCCACACCTAGACTAATT No data
Right 908903659 1:68984062-68984084 TAAATCAGGATTGCTAAAGGTGG No data
908903655_908903659 -7 Left 908903655 1:68984046-68984068 CCACACCTAGACTAATTAAATCA No data
Right 908903659 1:68984062-68984084 TAAATCAGGATTGCTAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908903659 Original CRISPR TAAATCAGGATTGCTAAAGG TGG Intergenic