ID: 908909385

View in Genome Browser
Species Human (GRCh38)
Location 1:69055469-69055491
Sequence CTCTAACACATGTGCAGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908909381_908909385 -2 Left 908909381 1:69055448-69055470 CCCACGATAGAAAATTCCATCCT No data
Right 908909385 1:69055469-69055491 CTCTAACACATGTGCAGTTAAGG No data
908909378_908909385 12 Left 908909378 1:69055434-69055456 CCTGCCCAGACATGCCCACGATA No data
Right 908909385 1:69055469-69055491 CTCTAACACATGTGCAGTTAAGG No data
908909382_908909385 -3 Left 908909382 1:69055449-69055471 CCACGATAGAAAATTCCATCCTC No data
Right 908909385 1:69055469-69055491 CTCTAACACATGTGCAGTTAAGG No data
908909380_908909385 7 Left 908909380 1:69055439-69055461 CCAGACATGCCCACGATAGAAAA No data
Right 908909385 1:69055469-69055491 CTCTAACACATGTGCAGTTAAGG No data
908909379_908909385 8 Left 908909379 1:69055438-69055460 CCCAGACATGCCCACGATAGAAA No data
Right 908909385 1:69055469-69055491 CTCTAACACATGTGCAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908909385 Original CRISPR CTCTAACACATGTGCAGTTA AGG Intergenic
No off target data available for this crispr