ID: 908914194

View in Genome Browser
Species Human (GRCh38)
Location 1:69107206-69107228
Sequence ACCACCATTAAAACATTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908914194_908914200 22 Left 908914194 1:69107206-69107228 CCAGGAAATGTTTTAATGGTGGT No data
Right 908914200 1:69107251-69107273 ATTCAACTGATGGTATGAGAAGG No data
908914194_908914199 12 Left 908914194 1:69107206-69107228 CCAGGAAATGTTTTAATGGTGGT No data
Right 908914199 1:69107241-69107263 GACAGCAGAGATTCAACTGATGG No data
908914194_908914201 26 Left 908914194 1:69107206-69107228 CCAGGAAATGTTTTAATGGTGGT No data
Right 908914201 1:69107255-69107277 AACTGATGGTATGAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908914194 Original CRISPR ACCACCATTAAAACATTTCC TGG (reversed) Intergenic
No off target data available for this crispr