ID: 908914201

View in Genome Browser
Species Human (GRCh38)
Location 1:69107255-69107277
Sequence AACTGATGGTATGAGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908914194_908914201 26 Left 908914194 1:69107206-69107228 CCAGGAAATGTTTTAATGGTGGT No data
Right 908914201 1:69107255-69107277 AACTGATGGTATGAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908914201 Original CRISPR AACTGATGGTATGAGAAGGC AGG Intergenic
No off target data available for this crispr