ID: 908918286

View in Genome Browser
Species Human (GRCh38)
Location 1:69158238-69158260
Sequence CTGCCTTTCTTCTCCTTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908918284_908918286 0 Left 908918284 1:69158215-69158237 CCTGGTCTATCCTGGTAAAACAG No data
Right 908918286 1:69158238-69158260 CTGCCTTTCTTCTCCTTCCTAGG No data
908918285_908918286 -10 Left 908918285 1:69158225-69158247 CCTGGTAAAACAGCTGCCTTTCT No data
Right 908918286 1:69158238-69158260 CTGCCTTTCTTCTCCTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908918286 Original CRISPR CTGCCTTTCTTCTCCTTCCT AGG Intergenic
No off target data available for this crispr