ID: 908920349

View in Genome Browser
Species Human (GRCh38)
Location 1:69183545-69183567
Sequence TTGTGATAGTAGGTGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908920346_908920349 24 Left 908920346 1:69183498-69183520 CCTGTTATAATGCCTAAAATTTG No data
Right 908920349 1:69183545-69183567 TTGTGATAGTAGGTGTGTGATGG No data
908920347_908920349 12 Left 908920347 1:69183510-69183532 CCTAAAATTTGCTTTAAAACACT No data
Right 908920349 1:69183545-69183567 TTGTGATAGTAGGTGTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908920349 Original CRISPR TTGTGATAGTAGGTGTGTGA TGG Intergenic
No off target data available for this crispr