ID: 908923927

View in Genome Browser
Species Human (GRCh38)
Location 1:69230380-69230402
Sequence CTGTGAACTCAGATGAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908923927_908923928 -8 Left 908923927 1:69230380-69230402 CCTTGACTCATCTGAGTTCACAG No data
Right 908923928 1:69230395-69230417 GTTCACAGTTGAATTATTTCAGG No data
908923927_908923929 -7 Left 908923927 1:69230380-69230402 CCTTGACTCATCTGAGTTCACAG No data
Right 908923929 1:69230396-69230418 TTCACAGTTGAATTATTTCAGGG No data
908923927_908923932 25 Left 908923927 1:69230380-69230402 CCTTGACTCATCTGAGTTCACAG No data
Right 908923932 1:69230428-69230450 TCATGCTGTCCCTGCACTAAGGG No data
908923927_908923931 24 Left 908923927 1:69230380-69230402 CCTTGACTCATCTGAGTTCACAG No data
Right 908923931 1:69230427-69230449 GTCATGCTGTCCCTGCACTAAGG No data
908923927_908923930 -2 Left 908923927 1:69230380-69230402 CCTTGACTCATCTGAGTTCACAG No data
Right 908923930 1:69230401-69230423 AGTTGAATTATTTCAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908923927 Original CRISPR CTGTGAACTCAGATGAGTCA AGG (reversed) Intergenic
No off target data available for this crispr