ID: 908927581

View in Genome Browser
Species Human (GRCh38)
Location 1:69274749-69274771
Sequence ATTGGTAAAGGGCAGTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908927577_908927581 20 Left 908927577 1:69274706-69274728 CCTAACAGAGTGTGAAATATTGT No data
Right 908927581 1:69274749-69274771 ATTGGTAAAGGGCAGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908927581 Original CRISPR ATTGGTAAAGGGCAGTCCTC AGG Intergenic
No off target data available for this crispr