ID: 908931452

View in Genome Browser
Species Human (GRCh38)
Location 1:69320892-69320914
Sequence GTGGTGTGCTTGAAGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908931448_908931452 21 Left 908931448 1:69320848-69320870 CCTCTAGAGTGATGGTGACAGAT No data
Right 908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908931452 Original CRISPR GTGGTGTGCTTGAAGAAAAA GGG Intergenic
No off target data available for this crispr