ID: 908934824

View in Genome Browser
Species Human (GRCh38)
Location 1:69362656-69362678
Sequence CTGTCGAATGGGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908934824_908934832 6 Left 908934824 1:69362656-69362678 CCTCCCACTTTCCCATTCGACAG No data
Right 908934832 1:69362685-69362707 CCAGATTCCAAACAACATTGGGG No data
908934824_908934829 4 Left 908934824 1:69362656-69362678 CCTCCCACTTTCCCATTCGACAG No data
Right 908934829 1:69362683-69362705 CTCCAGATTCCAAACAACATTGG No data
908934824_908934830 5 Left 908934824 1:69362656-69362678 CCTCCCACTTTCCCATTCGACAG No data
Right 908934830 1:69362684-69362706 TCCAGATTCCAAACAACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908934824 Original CRISPR CTGTCGAATGGGAAAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr