ID: 908945906

View in Genome Browser
Species Human (GRCh38)
Location 1:69496607-69496629
Sequence CAATCAAGCCAGAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908945901_908945906 -4 Left 908945901 1:69496588-69496610 CCCAAATATATGCATAAATCAAT No data
Right 908945906 1:69496607-69496629 CAATCAAGCCAGAGGGTGGATGG No data
908945902_908945906 -5 Left 908945902 1:69496589-69496611 CCAAATATATGCATAAATCAATC No data
Right 908945906 1:69496607-69496629 CAATCAAGCCAGAGGGTGGATGG No data
908945900_908945906 2 Left 908945900 1:69496582-69496604 CCATTGCCCAAATATATGCATAA No data
Right 908945906 1:69496607-69496629 CAATCAAGCCAGAGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908945906 Original CRISPR CAATCAAGCCAGAGGGTGGA TGG Intergenic
No off target data available for this crispr