ID: 908952640

View in Genome Browser
Species Human (GRCh38)
Location 1:69580031-69580053
Sequence GCATTTAGAGTGATTGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908952640_908952646 29 Left 908952640 1:69580031-69580053 CCATGAACAATCACTCTAAATGC No data
Right 908952646 1:69580083-69580105 GTGGTGTGAGAAAGAAATAAAGG No data
908952640_908952645 10 Left 908952640 1:69580031-69580053 CCATGAACAATCACTCTAAATGC No data
Right 908952645 1:69580064-69580086 GCACATAGGTATTTGACATGTGG 0: 1
1: 0
2: 0
3: 8
4: 102
908952640_908952642 -4 Left 908952640 1:69580031-69580053 CCATGAACAATCACTCTAAATGC No data
Right 908952642 1:69580050-69580072 ATGCAGTCCTCCTGGCACATAGG 0: 1
1: 0
2: 1
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908952640 Original CRISPR GCATTTAGAGTGATTGTTCA TGG (reversed) Intronic
No off target data available for this crispr