ID: 908953679

View in Genome Browser
Species Human (GRCh38)
Location 1:69594615-69594637
Sequence AAGTCTGTACGGATGGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908953679 Original CRISPR AAGTCTGTACGGATGGAGTA TGG (reversed) Intronic
903362026 1:22782912-22782934 AAGTCTGTGCGTGTGGAGCAGGG - Intronic
906905529 1:49886697-49886719 CAGTCTGTATGGAAGGAGAATGG - Intronic
908953679 1:69594615-69594637 AAGTCTGTACGGATGGAGTATGG - Intronic
909572455 1:77131402-77131424 AAGTCTCAACTAATGGAGTAAGG - Intronic
911974393 1:104473071-104473093 AAATCTGTAGGGCTGGAGTGAGG + Intergenic
916221817 1:162451811-162451833 CATTCTGTATGGATGGAGAATGG - Intergenic
921906683 1:220502597-220502619 AAGTCTGTAGGGATGGGGTGGGG + Intergenic
1074224223 10:111467802-111467824 GAGACTGAAAGGATGGAGTAGGG + Intergenic
1080413795 11:32051029-32051051 GAGCCTGTACTGATGGAATATGG + Intronic
1081254866 11:40879966-40879988 AAGTCTGTAACTATGGAGAAAGG + Intronic
1082631355 11:55545915-55545937 AAGATTGTAAAGATGGAGTAAGG - Intergenic
1083588090 11:63874901-63874923 AAGTCTGTTCCCATGGGGTAGGG + Intronic
1087175761 11:95093398-95093420 GAGTCTTAAAGGATGGAGTAAGG - Intronic
1087711890 11:101563632-101563654 AAGTCAGTATGAATGGAGTGAGG + Intronic
1089652920 11:119926383-119926405 AAGTCAGGGTGGATGGAGTAGGG - Intergenic
1098538265 12:71620753-71620775 AAGTGTGTTTTGATGGAGTAAGG - Intronic
1099289367 12:80756455-80756477 AAGTGTGTATGGATTGAGAATGG - Intergenic
1118305623 14:64652694-64652716 AAGTCTCTACCGAAGAAGTATGG + Intergenic
1124949137 15:34300331-34300353 AACTCTGTAAGGATTGAGAAGGG + Intronic
1131822001 15:96283180-96283202 AAGTATGTAGGGAAGGAGAAGGG + Intergenic
1141213572 16:82003509-82003531 AAGTCTGTACGGTTGGAGCACGG - Intronic
1146552161 17:33790602-33790624 AAGTCTGTAGGGCTGGAGTCAGG - Intronic
1147182840 17:38697575-38697597 ATGTCTGTAGGGGTGGAGAAGGG - Intergenic
1151708173 17:75783315-75783337 AAGTGTGTACTGGTGGAGTTGGG - Intronic
1152987325 18:332662-332684 AACACTGTAGGGATGGAGTGGGG - Intronic
936473086 2:112816059-112816081 AAGTCTGGACAGGTGGAGTGTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
940726076 2:157338022-157338044 AAGTCTGTGCAGAAGGAGCATGG - Intergenic
1177790922 21:25721423-25721445 AAGTGTGTATGGATGGATTTGGG + Intronic
1178292262 21:31378793-31378815 AAGCCTGTACATATGCAGTACGG - Intronic
1182236736 22:28882842-28882864 AAGTCTGCACTGAAGGAGTGGGG - Intergenic
949094549 3:70884-70906 AAGTGTGTGTGGAAGGAGTAGGG - Intergenic
950330739 3:12154283-12154305 AAGTCTTTAGGGATGGGGGAAGG - Intronic
953608594 3:44428706-44428728 AAGTCTGTACCCCTGGAGCATGG + Intergenic
959405029 3:105951210-105951232 AAAGCTGTACTGTTGGAGTAGGG - Intergenic
963754947 3:149225204-149225226 AATTCTGTTGGCATGGAGTAGGG - Intergenic
965736729 3:171828282-171828304 ACGACGGTAGGGATGGAGTAGGG + Intergenic
966734098 3:183175340-183175362 ACATCTGTAGGGATGGAGGAGGG - Intergenic
973821661 4:54667103-54667125 AAGTCTGTAAGCATGAAGGACGG + Intronic
976496865 4:85739977-85739999 AAGTCTGTGTGGCTGGAGCATGG - Intronic
977658207 4:99549209-99549231 CAGTCTGTCAGGATGGAGGAAGG - Exonic
979913784 4:126404801-126404823 ATTTCTGTACAGAAGGAGTAGGG - Intergenic
993458959 5:88159648-88159670 AAGTCTGTACATATTCAGTATGG + Intergenic
1000146786 5:158461256-158461278 AAGACTGTACTGATGGAGGAGGG + Intergenic
1005683317 6:28227994-28228016 AAGTCTGCACGCAGGGAGAAGGG - Intronic
1007465249 6:42047298-42047320 TAGCCTGTGCAGATGGAGTATGG + Intronic
1010535999 6:77031277-77031299 AGGTCTGTAAGGATTGAGTCAGG - Intergenic
1015825573 6:137307466-137307488 AGGTCTGTACCCATGAAGTATGG - Intergenic
1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG + Intronic
1029692139 7:102189590-102189612 AAGTGTGTAGGGATGCTGTAAGG - Intronic
1032120997 7:129156418-129156440 CAGTCTGCACTGAAGGAGTAAGG + Intronic
1035458874 7:159027118-159027140 AAGTTTGTACCGACGGAGGAAGG + Intergenic
1037141237 8:15522658-15522680 ATTTCTGTAGAGATGGAGTAGGG - Intronic
1039790390 8:40871364-40871386 GAGTGGGTAGGGATGGAGTAGGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1060111933 9:120912773-120912795 AATTCTGTACGCTTGGAGTATGG - Intronic
1188054794 X:25528367-25528389 AAGTCAGTATGGACGGAGCAGGG - Intergenic
1198160961 X:134007640-134007662 ATGACTGTACTGATGGGGTAAGG - Intergenic
1200963150 Y:9013287-9013309 AAGCCTGTACAGATGTTGTAGGG - Intergenic