ID: 908954116

View in Genome Browser
Species Human (GRCh38)
Location 1:69600349-69600371
Sequence TTGTTGCCATAGGCTCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908954111_908954116 5 Left 908954111 1:69600321-69600343 CCGGGATACCACATTGCCCTTAG 0: 1
1: 2
2: 32
3: 180
4: 513
Right 908954116 1:69600349-69600371 TTGTTGCCATAGGCTCCTCTTGG 0: 1
1: 0
2: 0
3: 28
4: 226
908954106_908954116 27 Left 908954106 1:69600299-69600321 CCCAGAGAATCATCCAGGATATC No data
Right 908954116 1:69600349-69600371 TTGTTGCCATAGGCTCCTCTTGG 0: 1
1: 0
2: 0
3: 28
4: 226
908954112_908954116 -3 Left 908954112 1:69600329-69600351 CCACATTGCCCTTAGTCATCTTG No data
Right 908954116 1:69600349-69600371 TTGTTGCCATAGGCTCCTCTTGG 0: 1
1: 0
2: 0
3: 28
4: 226
908954107_908954116 26 Left 908954107 1:69600300-69600322 CCAGAGAATCATCCAGGATATCC No data
Right 908954116 1:69600349-69600371 TTGTTGCCATAGGCTCCTCTTGG 0: 1
1: 0
2: 0
3: 28
4: 226
908954110_908954116 14 Left 908954110 1:69600312-69600334 CCAGGATATCCGGGATACCACAT 0: 1
1: 0
2: 0
3: 2
4: 54
Right 908954116 1:69600349-69600371 TTGTTGCCATAGGCTCCTCTTGG 0: 1
1: 0
2: 0
3: 28
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908954116 Original CRISPR TTGTTGCCATAGGCTCCTCT TGG Intronic
900035154 1:401660-401682 GGGTTGCCATAGGGTTCTCTGGG + Intergenic
900056774 1:637413-637435 GGGTTGCCATAGGGTTCTCTGGG + Intergenic
901571125 1:10161642-10161664 TTGTTCCTATGGGCTTCTCTAGG + Intronic
902421042 1:16280341-16280363 TTGTCTCCTTAGGCTCCTTTTGG - Intronic
902975862 1:20088046-20088068 TTGTCTCTTTAGGCTCCTCTTGG - Intronic
903033340 1:20478671-20478693 TTATTTCCCTAGGCTGCTCTTGG - Intergenic
904756993 1:32773460-32773482 GTGTTCCCACAGGCTTCTCTAGG + Exonic
907283382 1:53365232-53365254 GTGTCTCCCTAGGCTCCTCTTGG - Intergenic
907805443 1:57814615-57814637 TTGTTGGAATTGCCTCCTCTTGG - Intronic
908954116 1:69600349-69600371 TTGTTGCCATAGGCTCCTCTTGG + Intronic
909799439 1:79787608-79787630 ATGTTTCCTTAGGCTCCTCTTGG + Intergenic
910219076 1:84872032-84872054 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
910219182 1:84873095-84873117 ATGTCTCCTTAGGCTCCTCTTGG - Intronic
910900764 1:92118237-92118259 CTGTCTCCTTAGGCTCCTCTTGG + Intronic
911788529 1:101981447-101981469 CTGATGCCATATTCTCCTCTAGG + Intronic
916365022 1:164016851-164016873 ATGTTTCCTTAGGCTCCTCTTGG - Intergenic
920707751 1:208266879-208266901 ATGTTTCCCTAGGTTCCTCTTGG + Intergenic
921353252 1:214259627-214259649 TTGTTGCAATAGGCTCCTAACGG + Intergenic
921816639 1:219571476-219571498 ATGTCTCCATAGGCTTCTCTTGG + Intergenic
922077107 1:222255465-222255487 GTGTCTCCCTAGGCTCCTCTTGG - Intergenic
922257686 1:223907216-223907238 GGGTTGCCATAGGGTTCTCTGGG + Intergenic
923352506 1:233123020-233123042 CTGTTTCCTTAGGCTCCTCTTGG - Intronic
924338880 1:243009995-243010017 GGGTTGCCATAGGGTTCTCTGGG + Intergenic
924677751 1:246197608-246197630 GTGTTGCTTTAGGCTTCTCTTGG - Intronic
1063885054 10:10568870-10568892 TTATGGCCATAGGCTCCAATAGG - Intergenic
1066794446 10:39103693-39103715 TTTTCCCCATAGGCTTCTCTGGG - Intergenic
1067774355 10:49151718-49151740 GCATTGCCTTAGGCTCCTCTTGG - Intergenic
1068749474 10:60574892-60574914 TTGTTGACAAAGGCTTCTTTTGG - Intronic
1071680169 10:87697071-87697093 TTGTCTCCTTAGGTTCCTCTTGG + Intronic
1071882899 10:89918729-89918751 CTGTTTCCAGAGGGTCCTCTAGG + Intergenic
1072282132 10:93876000-93876022 TTGTTGCCACTGCCTCCTCATGG - Intergenic
1073425288 10:103452176-103452198 TTGTGGCCATGGCCTCCTCGGGG + Exonic
1073708036 10:106009531-106009553 TTGTCTCCATAGGGTCCTCTGGG + Intergenic
1075317526 10:121464873-121464895 TGGTTTCCCTAGCCTCCTCTTGG - Intergenic
1075985946 10:126785022-126785044 GTTTTCCCATGGGCTCCTCTAGG - Intergenic
1076156409 10:128209222-128209244 CTGTTTCCCTAGGCTCTTCTTGG - Intergenic
1076795520 10:132796224-132796246 TGGTGCCCAGAGGCTCCTCTGGG - Intergenic
1077668096 11:4133594-4133616 TTCATGCCATAGGCCCCGCTCGG - Exonic
1079652405 11:22946263-22946285 TTGTCTCCTTAGGCTCGTCTTGG + Intergenic
1080820130 11:35797765-35797787 AAGTTTCCATAGGCTCCTCTCGG - Intronic
1085164157 11:74381389-74381411 TTGTTGCTACATACTCCTCTAGG - Intronic
1086413006 11:86560815-86560837 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1088183420 11:107137358-107137380 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1089055361 11:115580693-115580715 TTGTGGCCAGAGGCTCAACTTGG + Intergenic
1089370001 11:117948600-117948622 ATGTCTCCATAGGCTCCTCTTGG - Intergenic
1090052219 11:123389492-123389514 TTATCTCCTTAGGCTCCTCTTGG - Intergenic
1093164129 12:15786399-15786421 ATGTCTCCCTAGGCTCCTCTTGG - Intronic
1093757522 12:22868918-22868940 TCCTTGCCATAGTCTTCTCTTGG - Intergenic
1093990441 12:25583994-25584016 TTGGTGCCATAGGCTCTCCCTGG - Intronic
1096228312 12:49883260-49883282 TTGTTGCCATGGCCTCCTGCAGG - Intronic
1097726308 12:63079276-63079298 TTTATACCATTGGCTCCTCTGGG + Intergenic
1098193815 12:67978327-67978349 ATGTGGCCATAGAATCCTCTTGG - Intergenic
1098705250 12:73678791-73678813 ATGTTCCCTTAGTCTCCTCTTGG - Intergenic
1098815875 12:75161559-75161581 TTATTGCCATCTTCTCCTCTAGG + Intronic
1100083894 12:90883696-90883718 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1100202007 12:92309010-92309032 ATGTCGCTTTAGGCTCCTCTTGG + Intergenic
1100811662 12:98344901-98344923 TTGTCGCCATTGGCTCCCCTGGG + Intergenic
1101599567 12:106197444-106197466 GTGTTTCTTTAGGCTCCTCTGGG + Intergenic
1104665508 12:130644729-130644751 TTGTGGCCATATGCTCCTGAGGG - Intronic
1105619944 13:22057053-22057075 ACGTTGCTTTAGGCTCCTCTGGG + Intergenic
1106127985 13:26916396-26916418 ATGTCTCCTTAGGCTCCTCTGGG + Intergenic
1106730945 13:32540888-32540910 ATGTTTCCTTAGGCTCCTTTTGG + Intergenic
1107630702 13:42340155-42340177 ACGTCTCCATAGGCTCCTCTTGG + Intergenic
1108114082 13:47108905-47108927 TTGAGACCATAGGCTCCTCCGGG + Intergenic
1109812853 13:67538008-67538030 TTGTTTCCTTAGGCTACTCTTGG - Intergenic
1110009693 13:70316631-70316653 ATGTTTCCATGGGATCCTCTAGG + Intergenic
1110083696 13:71348999-71349021 TTGTCTCCTTAGGCTCCTCCTGG - Intergenic
1111775113 13:92651536-92651558 ATGTCTCTATAGGCTCCTCTTGG - Intronic
1114467240 14:22931758-22931780 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
1115514109 14:34168092-34168114 CTGTGGCCACAGCCTCCTCTGGG + Intronic
1116324293 14:43512222-43512244 ATGTCTCCATAGGGTCCTCTTGG + Intergenic
1116444722 14:44995478-44995500 TTGTTGCCAGAGTCTGCTGTAGG + Intronic
1118736788 14:68706726-68706748 TTGTTGCCTTCTCCTCCTCTAGG + Intronic
1118883285 14:69846706-69846728 ATGTCTCCATAGGCTTCTCTTGG + Intergenic
1120398944 14:84003773-84003795 TTGTCTCCATAGGGTCCTCAGGG - Intergenic
1121488211 14:94337385-94337407 ATGTTTCCTTAGGCTTCTCTTGG + Intergenic
1122522342 14:102353726-102353748 TTGTTTCCTCAGGCTCCTTTTGG - Intronic
1122567033 14:102666580-102666602 TTGTTGCTTTAGGTTCCTCTTGG + Intronic
1122737592 14:103852235-103852257 TTGTCTCCTTAGACTCCTCTTGG + Intergenic
1122755766 14:103978553-103978575 ATGTTTCCTTAGGCTCCTCTTGG + Intronic
1125099931 15:35900723-35900745 ATGTTGTCTTAGGCTTCTCTTGG + Intergenic
1125922364 15:43532652-43532674 TAACTGCCATAGGCTCCTCTTGG + Intergenic
1125985911 15:44051653-44051675 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1127066610 15:55246474-55246496 TTGTTGCCCAAGGCTCTTCCAGG + Intronic
1128361714 15:66966362-66966384 ATGTCACCATAGGCTCCTCTTGG + Intergenic
1128982738 15:72198596-72198618 TTGTGGACCTAGGCTCCCCTTGG - Intergenic
1129351002 15:74956056-74956078 GGGTTCCCCTAGGCTCCTCTTGG + Exonic
1130474067 15:84247991-84248013 TGGTCGCCAGAGGCCCCTCTGGG + Intergenic
1130481482 15:84362059-84362081 TGGTCGCCAGAGGCCCCTCTGGG + Intergenic
1132190408 15:99851151-99851173 ATGTCTCTATAGGCTCCTCTTGG + Intergenic
1132855010 16:2040815-2040837 CTGTGGCCTGAGGCTCCTCTCGG + Intronic
1133433410 16:5758294-5758316 ATGTTGCCATAGTTACCTCTCGG + Intergenic
1137839297 16:51625220-51625242 TTTTTGCCATAGCCTCATTTTGG + Intergenic
1137929566 16:52574104-52574126 TTGTTGCCAGTGACCCCTCTGGG - Intergenic
1138413664 16:56858925-56858947 TTGTTGCCATAGCCTTCACCTGG + Intergenic
1138985693 16:62325727-62325749 TTGAGGCCATAGGATCCTTTAGG - Intergenic
1140668003 16:77245250-77245272 TTGTTGGCAAATGCTCTTCTAGG + Intergenic
1146524699 17:33556297-33556319 TTTATGCCTTAGGCCCCTCTAGG - Intronic
1147349879 17:39833995-39834017 TTGTCTCCTTAGGCTCCTCTTGG + Intronic
1147358252 17:39914378-39914400 ATGTCTCCTTAGGCTCCTCTTGG - Intronic
1149309030 17:55376319-55376341 CTGTCTCCTTAGGCTCCTCTTGG - Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1154347519 18:13555138-13555160 GTGTCTCCTTAGGCTCCTCTTGG - Intronic
1157036199 18:43978070-43978092 TTGTTGCCATAAAGACCTCTAGG + Intergenic
1159501502 18:69277129-69277151 TTGGCTCCTTAGGCTCCTCTTGG + Intergenic
1162350747 19:10147721-10147743 TGGTTGCCACCTGCTCCTCTGGG + Intronic
1164362325 19:27527730-27527752 TTTTTGCCATAGGCCTCTATGGG - Intergenic
1165680635 19:37771649-37771671 ATGTGGCCATAGACTTCTCTCGG - Exonic
1166585302 19:43941347-43941369 ATGTCTCCCTAGGCTCCTCTTGG + Intergenic
1167838302 19:52093442-52093464 TTGTTGCCACAGGCTGCTGGGGG + Intronic
925110365 2:1330401-1330423 TCTTTGCCATAGTCTCATCTAGG - Intronic
926617343 2:15010351-15010373 CTGTTCCCAGAGACTCCTCTGGG - Intergenic
927121447 2:19967979-19968001 ATGTCTCCTTAGGCTCCTCTGGG + Intronic
927264645 2:21131579-21131601 GTGTTGCAATAGGCTATTCTGGG - Intronic
927418167 2:22901699-22901721 TTGTTGCCATAGCATTCTCGGGG + Intergenic
928140654 2:28726039-28726061 TTGATGCCAGAGTCTCTTCTTGG + Intergenic
931318543 2:61154371-61154393 ATGTCTCCTTAGGCTCCTCTTGG - Intronic
931425613 2:62168460-62168482 TTATCTCCTTAGGCTCCTCTTGG - Intergenic
931709379 2:64975033-64975055 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
933375111 2:81469047-81469069 ATGTTTCCTTAGGCTTCTCTTGG + Intergenic
937350231 2:121155875-121155897 TTGATGACAGAGGCTGCTCTGGG - Intergenic
938164618 2:129016037-129016059 ATGTTGCCATTTGCTCCCCTGGG + Intergenic
938184176 2:129213570-129213592 GTCTTGCCACAGGTTCCTCTGGG - Intergenic
940280467 2:151983420-151983442 TTGTTTCCATTTGCGCCTCTTGG - Intronic
942196537 2:173526152-173526174 TTTTTGCCTTTGGCTTCTCTTGG + Intergenic
942979163 2:182058184-182058206 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
942980183 2:182071225-182071247 ATGTCTCCTTAGGCTCCTCTGGG + Intronic
943850694 2:192718551-192718573 TTATTGCCATAGGATCCTAAGGG + Intergenic
945558321 2:211306493-211306515 ATGTCTCCATAGGCTCCTCTTGG - Intergenic
946799147 2:223391657-223391679 GTGTCTCCTTAGGCTCCTCTTGG + Intergenic
1169418239 20:5436315-5436337 ATGTTCCCTTAGGCTCCTCTTGG + Intergenic
1172901148 20:38335720-38335742 TTGCAGCCATAGGCTGCTGTTGG - Intronic
1174728260 20:52888264-52888286 ATGTCTCCATAGGCTCCTCCTGG - Intergenic
1175004872 20:55671309-55671331 TTGTTGCCATATACTCTTATAGG + Intergenic
1176158715 20:63637442-63637464 TTGATGCCAGAGGCTCCACATGG + Intergenic
1179401410 21:41087522-41087544 TTCTTGACACAGGCTCATCTTGG + Intergenic
1180999743 22:19982440-19982462 TGGCTGCCACAGGCTCCTCCAGG + Intronic
1181739843 22:24912127-24912149 ATGTTCCCTTAAGCTCCTCTTGG - Intronic
1184286803 22:43476612-43476634 ATCTTGCCATAGCCTCCTCATGG + Intronic
949739929 3:7220525-7220547 TTGTCTCCTTAGGCTCCTCTTGG - Intronic
950933834 3:16818573-16818595 GTGTTTCCCTAGACTCCTCTAGG - Intronic
951528159 3:23673308-23673330 TTGTCTCTTTAGGCTCCTCTTGG + Intergenic
952400892 3:32962227-32962249 TTGTCTCCTTAGGCTCCCCTTGG - Intergenic
957504044 3:81096852-81096874 TTGTACCCATATTCTCCTCTTGG - Intergenic
957679908 3:83420387-83420409 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
960226321 3:115173626-115173648 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
960250977 3:115453094-115453116 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
960790907 3:121429804-121429826 TTGTTGGCATCGCTTCCTCTGGG + Intergenic
963492852 3:146022546-146022568 GTGTCTCCTTAGGCTCCTCTGGG - Intergenic
963610703 3:147464306-147464328 TTGTTGCCTCTGGCCCCTCTAGG - Intronic
963907536 3:150785270-150785292 ATGTTTCCTTAGGCTCCTCTTGG + Intergenic
964865608 3:161256787-161256809 ATGTTTCCTTATGCTCCTCTTGG + Intergenic
967456625 3:189694432-189694454 ATGTTGCCTTAGGTTCCCCTTGG + Intronic
968113269 3:196067647-196067669 TTGTTTTCCTAGGCTCATCTGGG - Exonic
969513460 4:7632812-7632834 TGGTGGCCCTAGGGTCCTCTTGG - Intronic
970268170 4:14312637-14312659 TTATTACCAGAGGCTCCTGTGGG + Intergenic
970400755 4:15715336-15715358 TTGATGGGATAGGCTCCTGTTGG - Exonic
970560601 4:17278333-17278355 TTGTGGCCATATTCTCCTTTGGG + Intergenic
971142869 4:23943982-23944004 ATGTCTCCATAGGCTTCTCTGGG - Intergenic
974699566 4:65423042-65423064 ATGTTTTCTTAGGCTCCTCTTGG + Intronic
974925767 4:68295984-68296006 TTGTTGCTATAGGCTCCTTCTGG - Intergenic
975616648 4:76253600-76253622 TGGTTGCCTTACTCTCCTCTTGG + Intronic
975892464 4:79045971-79045993 TTGTTACATTAGGCTCCTTTGGG - Intergenic
977428207 4:96896712-96896734 TTCTTGCCAGAGGCTCTCCTGGG - Intergenic
979238240 4:118425243-118425265 GGGTTGCCATAGGGTTCTCTGGG - Intergenic
981016758 4:139981676-139981698 ATGTTTCATTAGGCTCCTCTTGG + Intronic
982062167 4:151615577-151615599 GTGTTGACAGAGGCTCATCTGGG + Intronic
982367738 4:154598619-154598641 TTGTTGCCATTGGCTCATTCTGG - Intergenic
983968318 4:173841869-173841891 TAGTTGCCATAGGCACCACGTGG - Intergenic
986577830 5:9230722-9230744 TGATTGCCACAGGCTCCTCTGGG - Intronic
986704062 5:10441093-10441115 TGCTTGCCATCGGCCCCTCTGGG + Intergenic
986758963 5:10862672-10862694 TTGCTGCCCTAGGACCCTCTTGG + Intergenic
987117189 5:14735138-14735160 TTTTTGCCAAAGGTTTCTCTGGG - Intronic
988011147 5:25487843-25487865 ATGCTTCCTTAGGCTCCTCTCGG + Intergenic
988714335 5:33810276-33810298 TTTTTGAGATAGGTTCCTCTTGG + Intronic
990208946 5:53460735-53460757 CTATTTCCTTAGGCTCCTCTTGG - Intergenic
994916565 5:105988052-105988074 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
999547768 5:152649758-152649780 TTTTTGGCATAGGATCCTTTTGG - Intergenic
1002738665 5:181417211-181417233 GGGTTGCCATAGGGTTCTCTGGG - Intergenic
1003015821 6:2466772-2466794 CTGTGGCCAGAGGCTTCTCTGGG + Intergenic
1003474942 6:6472602-6472624 ATGTGGCCATAAGCTCTTCTTGG - Intergenic
1004777373 6:18863020-18863042 ATGTCTCCATAGGTTCCTCTTGG + Intergenic
1004799327 6:19128937-19128959 GTGTTTTCTTAGGCTCCTCTTGG - Intergenic
1005473974 6:26189243-26189265 TTGTTGCCTCAGGCCCCTCTTGG - Intergenic
1006455857 6:34131520-34131542 CTTTTGCCATTGGCTGCTCTGGG - Intronic
1006882334 6:37351270-37351292 GTGTCTCCTTAGGCTCCTCTTGG - Intergenic
1007117779 6:39356046-39356068 GTGTCTCCCTAGGCTCCTCTTGG + Intronic
1007289221 6:40772552-40772574 TTGTTTCCAAAGCCTCCACTAGG - Intergenic
1007670430 6:43548295-43548317 CTGGTGCCATCAGCTCCTCTAGG + Exonic
1007851899 6:44811164-44811186 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1009494265 6:64329099-64329121 TTGAGACCATAGGCTCCTCGGGG - Intronic
1010200974 6:73281824-73281846 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1010340124 6:74740554-74740576 TTGTCTTCCTAGGCTCCTCTTGG - Intergenic
1010783563 6:79973074-79973096 ATGTTTCCTTAGGCTCCTCTTGG - Intergenic
1011006767 6:82654326-82654348 ATGTTGACATAGGATTCTCTAGG + Intergenic
1011167610 6:84466858-84466880 TTGCTGCCATTGGCCACTCTTGG + Intergenic
1013185744 6:107756498-107756520 ATGTTTCCTTAAGCTCCTCTGGG - Intronic
1016639602 6:146333826-146333848 TTGTTTCTTTAGGCTTCTCTGGG - Intronic
1016640488 6:146343033-146343055 TTGTTTCCTTAGGCTTCCCTGGG + Intronic
1017516915 6:155164670-155164692 TTGTTGCCATCGGCACTTGTGGG + Intronic
1017867644 6:158457816-158457838 TTGATGCCATCTGCTCCTGTGGG + Intronic
1019243769 6:170692763-170692785 GGGTTGCCATAGGGTTCTCTGGG - Intergenic
1020992308 7:15214969-15214991 CTGTTGGCATAGGCTCTTATAGG - Intronic
1021333756 7:19372459-19372481 CTGTTTCCTTAGGCTCCACTTGG + Intergenic
1021348573 7:19559144-19559166 TTGTCTCCTTCGGCTCCTCTTGG + Intergenic
1021440618 7:20670120-20670142 ATGTCGCCTTAGGCTCCTCTTGG - Intronic
1021874318 7:25034287-25034309 GTGTCTCCTTAGGCTCCTCTTGG + Intergenic
1022016283 7:26351536-26351558 GTGTTTCCTTGGGCTCCTCTTGG - Intronic
1023274699 7:38505764-38505786 TTGTTGCAATATGCTTTTCTTGG - Intronic
1028085354 7:86629775-86629797 GTGTTTCTTTAGGCTCCTCTTGG + Intergenic
1030269433 7:107654564-107654586 CTGTTTCCTTAGGCTCCACTTGG - Intergenic
1030310201 7:108061177-108061199 TTATTTCCTGAGGCTCCTCTTGG - Intronic
1030506711 7:110433775-110433797 TTCTTCCCAGAGGCTCCTCCTGG + Intergenic
1031008674 7:116500739-116500761 TTCTTACCACAGGCTGCTCTCGG + Intronic
1031297802 7:120026029-120026051 ATGTCCCCTTAGGCTCCTCTTGG + Intergenic
1031953624 7:127918610-127918632 TTGGTGCCATATACTCTTCTAGG - Intronic
1032740460 7:134733357-134733379 TTTTTCCCATAAACTCCTCTGGG - Intergenic
1035504354 8:115397-115419 GGGTTGCCATAGGGTTCTCTGGG + Intergenic
1036536075 8:9653958-9653980 TTGTTTCCTTAGGCTCTTCATGG + Intronic
1038756801 8:30349277-30349299 TTGTCTCCTTAGGCTCCTCTTGG + Intergenic
1039559096 8:38498295-38498317 ATGTGCCCATAGGGTCCTCTTGG - Intergenic
1039714289 8:40091392-40091414 GTGTCTCCATAGGCTCCTTTTGG + Intergenic
1041440690 8:57893195-57893217 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
1041737845 8:61130811-61130833 TTGCTGCCAGAGGCTCCTTAGGG + Intronic
1041761549 8:61372674-61372696 ATGTTTCTTTAGGCTCCTCTTGG + Intronic
1042842363 8:73136722-73136744 TTGTTGAGAGAGGCTTCTCTGGG - Intergenic
1045019968 8:98033870-98033892 TAGTTGCCATCGGCTGTTCTCGG + Intronic
1045416548 8:101973258-101973280 ATGTCTCCATAGGCTCCTCTTGG + Intronic
1045469401 8:102497649-102497671 GTGTTGCCTCTGGCTCCTCTAGG - Intergenic
1046821185 8:118636074-118636096 TTATTGCCATTGCCTCGTCTGGG - Intergenic
1047779445 8:128099391-128099413 TGGTGGCCCCAGGCTCCTCTGGG - Intergenic
1049479371 8:142813587-142813609 ATGTTTACAGAGGCTCCTCTGGG - Intergenic
1051261145 9:15265946-15265968 ATGTCCCCTTAGGCTCCTCTTGG - Intronic
1053328350 9:37177866-37177888 ATGTCTCCCTAGGCTCCTCTTGG - Intronic
1058534011 9:105936223-105936245 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1059105785 9:111510260-111510282 TTAATACCATAGTCTCCTCTGGG - Intergenic
1059714486 9:116900886-116900908 TTTTTGCCATAAGCTTCTCCCGG + Intronic
1059841594 9:118223541-118223563 CTTTTGCCATAGGCTCCTCCTGG - Intergenic
1203603958 Un_KI270748v1:41986-42008 GGGTTGCCATAGGGTTCTCTGGG - Intergenic
1186440220 X:9579678-9579700 TTGTTTCCATCGGGTCCTGTGGG + Intronic
1189776618 X:44475558-44475580 TGTTAGCCAGAGGCTCCTCTTGG - Intergenic
1190651871 X:52575825-52575847 TTGAGACCATAGGCTCCTCGGGG + Intergenic
1190714133 X:53089798-53089820 TTGTGTCCTTAAGCTCCTCTTGG + Intergenic
1192607902 X:72538978-72539000 TTGTCTCCTTAGGCTCCTCTTGG - Intronic
1192734592 X:73837439-73837461 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1194162482 X:90471532-90471554 ATGTTTTCTTAGGCTCCTCTTGG - Intergenic
1195530867 X:105956113-105956135 TTGTCGCCATAGTTTTCTCTGGG - Exonic
1196262063 X:113594567-113594589 ATGTTTCCTTAGGCTCCTCTTGG + Intergenic
1199584288 X:149397101-149397123 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1200508762 Y:4049272-4049294 ATGTTTTCTTAGGCTCCTCTTGG - Intergenic
1201896363 Y:18996841-18996863 TTGAGACCATAGGCTCCTCCGGG - Intergenic
1202376852 Y:24246061-24246083 TGGTCGCCAGAGGCCCCTCTGGG - Intergenic
1202386017 Y:24327035-24327057 AGGTTGCCATAGGGTTCTCTGGG - Intergenic
1202484769 Y:25343093-25343115 AGGTTGCCATAGGGTTCTCTGGG + Intergenic
1202493928 Y:25424060-25424082 TGGTCGCCAGAGGCCCCTCTGGG + Intergenic