ID: 908964305

View in Genome Browser
Species Human (GRCh38)
Location 1:69739382-69739404
Sequence CTACATTCCTGGGCTTACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908964305_908964310 5 Left 908964305 1:69739382-69739404 CCCCTGTAAGCCCAGGAATGTAG No data
Right 908964310 1:69739410-69739432 GAAATTCTTTCTACCCACCAAGG No data
908964305_908964314 22 Left 908964305 1:69739382-69739404 CCCCTGTAAGCCCAGGAATGTAG No data
Right 908964314 1:69739427-69739449 CCAAGGATAAGAACAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908964305 Original CRISPR CTACATTCCTGGGCTTACAG GGG (reversed) Intronic
No off target data available for this crispr