ID: 908965919

View in Genome Browser
Species Human (GRCh38)
Location 1:69762704-69762726
Sequence AACTCACTAGGATCCTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908965916_908965919 3 Left 908965916 1:69762678-69762700 CCATTGAAAAGTCTTATACATCA 0: 1
1: 0
2: 2
3: 18
4: 222
Right 908965919 1:69762704-69762726 AACTCACTAGGATCCTAAGTAGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908965919 Original CRISPR AACTCACTAGGATCCTAAGT AGG Intronic
902125560 1:14207702-14207724 AACTCACCAGGATTCTAAAATGG - Intergenic
903080067 1:20803390-20803412 AAGTCAATAGAATTCTAAGTTGG - Intergenic
908965919 1:69762704-69762726 AACTCACTAGGATCCTAAGTAGG + Intronic
916884922 1:169058038-169058060 AACTCACTCGCCTCCTAAGGAGG - Intergenic
917785587 1:178453175-178453197 AACTTATTTGGATCTTAAGTTGG + Intronic
919112011 1:193232476-193232498 AGCTCACTCAGACCCTAAGTTGG - Intronic
919212267 1:194502679-194502701 AAATCAATAGGAACATAAGTAGG - Intergenic
1062787709 10:278992-279014 AACTCACTATTGTTCTAAGTGGG + Intronic
1065902248 10:30219166-30219188 AACTTAATAGGATCCTGAATTGG + Intergenic
1067747222 10:48944955-48944977 CACTCACTGGGATCTTAAGAGGG + Intronic
1087386836 11:97482719-97482741 AGATCTCTAGGATCCTAGGTGGG + Intergenic
1090704095 11:129320994-129321016 CAGCCACTAGGATTCTAAGTAGG + Intergenic
1092338706 12:7657013-7657035 AACACACTAGGACACCAAGTGGG - Intronic
1094389810 12:29936640-29936662 AACTCACTAGGATGCTTCTTTGG - Intergenic
1094806933 12:34102754-34102776 AACTCACTAAAATGCTAATTAGG + Intergenic
1096939363 12:55325407-55325429 AACTCACTAAAATGCTAATTAGG + Intergenic
1099956731 12:89358382-89358404 AACTCATTATTTTCCTAAGTGGG + Intergenic
1102426382 12:112847522-112847544 AACTCATTAGAAGCCTAAGAGGG + Intronic
1108808041 13:54184255-54184277 AACTCATAAGGAACATAAGTGGG - Intergenic
1110511621 13:76357372-76357394 AACCAACTAAGATCCTATGTGGG + Intergenic
1114757411 14:25275524-25275546 AAGTCACTAGCATCCCAAGGTGG - Intergenic
1115119049 14:29917823-29917845 AACGCAATAGGATCCTTACTTGG + Intronic
1124858272 15:33412032-33412054 GACACACTGGGAACCTAAGTTGG - Intronic
1137014223 16:35357958-35357980 AACCTACTAGGCTCCTGAGTGGG - Intergenic
1139516760 16:67456939-67456961 AGCTCATGAGGATCCTGAGTAGG - Intronic
1141809305 16:86364147-86364169 AACTCACGATGATCATAAGTAGG + Intergenic
1142788482 17:2244339-2244361 CACTCACTAGGGACCTAAGCCGG + Intronic
1151694701 17:75708329-75708351 AACTCACGAGGCTGGTAAGTGGG - Intergenic
1156818563 18:41342318-41342340 AAATTACTAGGCTGCTAAGTGGG + Intergenic
927627243 2:24734692-24734714 AACTACTTAGGAGCCTAAGTTGG + Intronic
930395406 2:50817179-50817201 AAGTCACTAAGATTCTAACTGGG - Intronic
935749207 2:106215491-106215513 AACTCACTAAAATGCTAATTAGG + Intergenic
937623678 2:124020023-124020045 AACTCTTTAGGTTCCTAAATTGG + Intergenic
938705791 2:133924345-133924367 AACTCTCTAGAACCCTAAGATGG + Intergenic
943459735 2:188156827-188156849 AACTCACTAGGATTTTAATAAGG + Intergenic
945078458 2:206064332-206064354 AGCTCACTAAGATCCTGACTTGG - Intronic
947164857 2:227251476-227251498 AACTCACAAGGATCCCTAGCAGG + Intronic
948451962 2:238081179-238081201 ATTTCAGTAGGATCCTGAGTGGG + Intronic
1169471888 20:5893320-5893342 AACTCTCTGGGATCTGAAGTTGG - Intergenic
1170904369 20:20499499-20499521 AGCTTACCAGGATCCTAAGCTGG - Intronic
1178716656 21:34970595-34970617 ACCTCACTGGGCTCCTACGTTGG + Intronic
1181947308 22:26528218-26528240 AAATCACGAGCTTCCTAAGTGGG + Exonic
950681649 3:14589075-14589097 AACTCACACAAATCCTAAGTGGG + Intergenic
951637235 3:24792983-24793005 AACTCACTTGGAAGCTAAATAGG - Intergenic
952005323 3:28836472-28836494 AACTCACCAGTGTCCCAAGTAGG - Intergenic
953016067 3:39077561-39077583 AACTCACCAGGATTCAAATTTGG + Intronic
954220466 3:49150461-49150483 AGGTCACTAGGATCTTAAGAGGG - Intergenic
957998944 3:87727422-87727444 CACACACTAGGATCCTCTGTTGG - Intergenic
958514178 3:95091257-95091279 AACCCAGTAGGCTCCTAAGTGGG + Intergenic
963284926 3:143424905-143424927 AATTCACAAGGACCCTAGGTTGG - Intronic
968749474 4:2380249-2380271 AACTCACTAGTTGCCAAAGTAGG + Intronic
978527701 4:109682050-109682072 AACTCACTAAAATGCTAATTAGG - Intronic
980467242 4:133202103-133202125 AACTCCCTAGGATGTGAAGTAGG + Intronic
987719455 5:21615596-21615618 AGCTCACTAAGATGCTAATTAGG - Intergenic
988025561 5:25683557-25683579 AACCAACTAGGAGCCTACGTGGG + Intergenic
988142213 5:27258206-27258228 ACCTTACTAGAATCCTAACTAGG + Intergenic
990902346 5:60766031-60766053 TCCTCACTAGGATCTGAAGTAGG + Intronic
995465133 5:112443820-112443842 AACTCACTAAAATTCTAATTAGG + Intergenic
995466125 5:112450859-112450881 AACTCACTAAAATGCTAATTAGG + Intergenic
996322071 5:122229888-122229910 AACTCACTAGAATGCTAATTAGG - Intergenic
998035002 5:138907669-138907691 AATTCACTAGGAGCTTAATTTGG + Intronic
1000125385 5:158238706-158238728 ATCCCACTGGGATCCTAAATAGG - Intergenic
1000128299 5:158269118-158269140 AAATCACAAGGCTTCTAAGTTGG - Intergenic
1000756929 5:165173015-165173037 AAGTCACTAGGATGATAATTTGG - Intergenic
1001692164 5:173641333-173641355 AACTCACCAGGGTCCTGAGAAGG - Intergenic
1007949044 6:45853277-45853299 AGCTCAGTAGTATCCTAATTTGG + Intergenic
1008582811 6:52921760-52921782 AGCTCACTAAGATGCTAATTAGG - Intergenic
1008805339 6:55419990-55420012 AAGTCACTGGCATCCTAATTAGG + Intergenic
1009752331 6:67888676-67888698 CAACCACTAGGATCCTCAGTGGG + Intergenic
1013027345 6:106289588-106289610 AACTCTTTGGGATCCTTAGTAGG - Intronic
1024545383 7:50513328-50513350 AACTCACTGGGTTCCCAAGCAGG + Intronic
1027524852 7:79255237-79255259 TACTCATTAGAATCCTAAGTGGG + Intronic
1031681556 7:124681067-124681089 ATTTCACTTGTATCCTAAGTAGG + Intergenic
1033150824 7:138913780-138913802 AACCCACTTGGAGCCTATGTGGG - Intronic
1037123452 8:15317250-15317272 AACTCACTAAAATGCTAATTAGG - Intergenic
1038159464 8:25023027-25023049 AACTCACTAGCAGCATAAATGGG - Intergenic
1038513667 8:28164509-28164531 AACTCACTAGAGTCCCAAGAAGG - Intronic
1042745569 8:72102585-72102607 AACTCAGATGGATCCTAATTAGG + Intronic
1044298076 8:90551578-90551600 AATCCTCTAGGATTCTAAGTGGG + Intergenic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1053875067 9:42536004-42536026 TAAAAACTAGGATCCTAAGTGGG - Intergenic
1054236630 9:62565715-62565737 TAAAAACTAGGATCCTAAGTGGG + Intergenic
1058175558 9:101732533-101732555 AAAAAACTAGGTTCCTAAGTAGG - Intronic
1060003236 9:119977414-119977436 AAGTCACCTGGATCCTCAGTGGG + Intergenic
1191799172 X:65058500-65058522 AACTCACAAGTAGCCTAACTGGG - Intergenic
1193586472 X:83328120-83328142 AACTAACTGGGATCCTCAGTTGG + Intergenic
1193701100 X:84761988-84762010 AGCTCACTACAATGCTAAGTAGG + Intergenic