ID: 908968573

View in Genome Browser
Species Human (GRCh38)
Location 1:69796864-69796886
Sequence CTCCTTATGTATACAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908968573 Original CRISPR CTCCTTATGTATACAGTGTC AGG (reversed) Intronic
901213227 1:7538322-7538344 CTCCTTGTGTATTCAGTTGCAGG - Intronic
902136170 1:14307430-14307452 GACCTAATGTAGACAGTGTCTGG - Intergenic
904090732 1:27943342-27943364 CTCCTGATCTAAACAGTCTCAGG - Intronic
905400194 1:37696092-37696114 GGTCTCATGTATACAGTGTCTGG - Intronic
908968573 1:69796864-69796886 CTCCTTATGTATACAGTGTCAGG - Intronic
910436875 1:87214268-87214290 CTCCTTGTTTATACAGAGTTTGG - Intergenic
911352241 1:96767337-96767359 CTCCTTATGGGTACAGTGATAGG + Intronic
912986048 1:114432187-114432209 CTACTTTTGTATACAGATTCTGG + Intronic
917352907 1:174096673-174096695 GTCCCTATGAATACAGTGTACGG - Intergenic
917539619 1:175900128-175900150 CTACTTATGTATGCAGTATCAGG + Intergenic
920281971 1:204850347-204850369 CTCCTTGTGTATAAGGTGTGAGG + Intronic
921144436 1:212339569-212339591 CACCTAATGTTTACTGTGTCAGG + Intronic
922908554 1:229196144-229196166 GTCTTTATGTATACATTGTTTGG - Intergenic
924033480 1:239910827-239910849 CTGCTTTTGTATTCAGTGTGAGG + Exonic
924926334 1:248686789-248686811 CTCAATATGTATTCACTGTCTGG + Intergenic
1064168886 10:13011667-13011689 CTACTTATGTGAACAATGTCAGG - Intronic
1065932514 10:30492138-30492160 CTCCTGATGTATATCCTGTCTGG - Intergenic
1073883781 10:108014112-108014134 TTCCTTATATATACAGGTTCTGG + Intergenic
1074318450 10:112379669-112379691 CTCCTTCTGTGTACAGTGGCGGG + Intronic
1078370301 11:10739052-10739074 CTCCATATGTTTACAGTCTTTGG - Intergenic
1084205157 11:67586876-67586898 CTCCTTCTATATACACTGTGTGG - Intergenic
1086309707 11:85522132-85522154 CTCTTGCTGTATACAGTCTCAGG + Intronic
1093645488 12:21581354-21581376 CTGCTTTTCCATACAGTGTCTGG - Intronic
1093807020 12:23446821-23446843 GTCCTTATGTATTCTGTGTGAGG - Intergenic
1101907684 12:108839900-108839922 CTTGTTCTGTGTACAGTGTCTGG - Intronic
1106825483 13:33515769-33515791 CTCATTATGTATTTAGTGTGAGG - Intergenic
1107169751 13:37326848-37326870 CTTCTTTTGTATACAGTGTATGG - Intergenic
1108739099 13:53316708-53316730 CTCATTATGAACACAGTGCCAGG + Intergenic
1109872457 13:68351718-68351740 ATTCTTATTTATACAATGTCAGG + Intergenic
1118651345 14:67898576-67898598 CTCTTTATTTATACAGTGTATGG - Intronic
1123784289 15:23653755-23653777 CTCTTTATGTATACATTTTATGG + Intergenic
1124578644 15:30931589-30931611 CGCCATTTGTATACAGTGTGGGG + Intronic
1126147065 15:45484930-45484952 CTCATTCTGTAAACAGTGTTTGG + Exonic
1130074896 15:80680164-80680186 CTACTTATGTAAACAGTGCAAGG + Intronic
1134394837 16:13853347-13853369 CTCCTAATGTTTACAGCATCTGG + Intergenic
1136339806 16:29635054-29635076 CTCCCTATTTATAAAATGTCCGG + Intergenic
1136714592 16:32268123-32268145 TTCATTTTGTATACAGTGTAAGG + Intergenic
1141036849 16:80633940-80633962 CTCCTGATGTATCCTGTGTGAGG - Intronic
1142042477 16:87903611-87903633 CTCCCTATTTATAAAATGTCCGG + Intronic
1203055459 16_KI270728v1_random:921646-921668 TTCATTTTGTATACAGTGTAAGG - Intergenic
1142486521 17:251076-251098 CTCCTTATGCTCACAGTGCCAGG + Intronic
1144306243 17:13971739-13971761 CTCCTTCTCTTTACATTGTCAGG - Intergenic
1144995171 17:19263072-19263094 CTCCTTATCTATCCAGAGACAGG - Intronic
1147518803 17:41148570-41148592 CTCTTAATGGATACAGTTTCTGG - Intergenic
1151086173 17:71383741-71383763 CTACTTATTTTTACAGAGTCAGG + Intergenic
1151999271 17:77635230-77635252 CTCCTTAAGTCCCCAGTGTCCGG + Intergenic
1156257939 18:35416174-35416196 CCCTTTATGTATACCCTGTCTGG - Intergenic
1159591142 18:70336483-70336505 CTCCTGACGTGTACAGGGTCAGG + Exonic
1161901626 19:7123614-7123636 CTCCTAATGTATAAAGGGTTTGG + Intronic
1164121160 19:22266354-22266376 ATGCTTCTGTATAAAGTGTCTGG - Intergenic
1168147214 19:54426521-54426543 CTCCTGCTGTTTACTGTGTCTGG - Intronic
1168158786 19:54494082-54494104 CTCCTTGGCTATACAGTCTCAGG + Intergenic
928868696 2:35949562-35949584 CTCCATATGTAAAAATTGTCAGG - Intergenic
935937331 2:108200848-108200870 CTCCTTATCTATGCAGCGGCAGG - Intergenic
938807322 2:134818338-134818360 TTCATTATGGAGACAGTGTCAGG + Intergenic
941913630 2:170791866-170791888 CTACTTCTGAAAACAGTGTCTGG + Intronic
944145211 2:196500319-196500341 CTGCTAATGCTTACAGTGTCTGG - Intronic
946875355 2:224124291-224124313 ATCTTTATGTTGACAGTGTCTGG - Intergenic
1173441150 20:43077409-43077431 CTCCCTATGTTGACAGTGTGTGG - Intronic
1174789616 20:53465157-53465179 CTCCTTATGGATGAAGTTTCGGG - Intronic
949796988 3:7862306-7862328 TTCCTGATGAATACAGTTTCAGG - Intergenic
951753868 3:26067627-26067649 CTCCTAAAGGGTACAGTGTCAGG + Intergenic
957434053 3:80151699-80151721 TTTCTTCTGTATAGAGTGTCTGG + Intergenic
964801455 3:160564232-160564254 CACCTTATGTAGACAATCTCGGG + Intronic
968182426 3:196606043-196606065 CCCCTCATGTATAAACTGTCTGG - Intergenic
969818382 4:9702936-9702958 CTCCTTAGGGAAACAGTTTCTGG - Intergenic
970196631 4:13557389-13557411 CTCCTTATGGCAACAGTTTCCGG - Intergenic
974068752 4:57104989-57105011 CTCCTTATAAACACAGTGTCTGG - Intronic
975462830 4:74674630-74674652 ATCCTTATGAATACAGTTTAAGG - Intergenic
978825783 4:113021617-113021639 CTCCTTATAAAGACAGTGTCGGG - Intronic
979191204 4:117860939-117860961 CTCCTTATGGAAGCAGTGACTGG + Intergenic
981766441 4:148255664-148255686 CTCAGTATGTATGCAGTGTCTGG - Intronic
982222516 4:153137130-153137152 CTCCTTCTGCATCCAGTGCCTGG + Intergenic
983287185 4:165754631-165754653 TTCCTGATGGTTACAGTGTCAGG - Intergenic
993661650 5:90645086-90645108 CTGCTCATGTATCCAGTATCAGG + Intronic
995205368 5:109473592-109473614 TTCCTTGTATATACAGTGCCTGG - Intergenic
996320588 5:122210938-122210960 CTCAATATCTAGACAGTGTCTGG - Intergenic
1001048591 5:168395535-168395557 CACCTTAAGCATACAGTGTGGGG - Intronic
1003210822 6:4064785-4064807 CTCCTTCTGTATATAGGGTAAGG + Intronic
1003301691 6:4889802-4889824 TTCCTTATGTATACTCAGTCTGG + Intronic
1003418530 6:5935213-5935235 CACATTGTGTATACAGAGTCAGG - Intergenic
1008283702 6:49624689-49624711 CTCCTCATGTCTCCAGTATCTGG + Intronic
1009023513 6:57970680-57970702 CTCCTTCTGTATAGAATTTCTGG - Intergenic
1009199085 6:60722245-60722267 CTCCTTCTGTATAGAATTTCTGG - Intergenic
1009496146 6:64350473-64350495 CTCCTTATGTTTTCAAAGTCTGG - Intronic
1015521350 6:134134700-134134722 CTCCTTCTGTAAACAGTGCTAGG - Intergenic
1016358031 6:143238925-143238947 GTAATTATGTCTACAGTGTCTGG - Intronic
1016531517 6:145063379-145063401 TTACTTATGTATACAGTCTTTGG - Intergenic
1017390448 6:153933241-153933263 CTCCTTATTTCTAGAGTGTCAGG - Intergenic
1020257835 7:6511917-6511939 CTCTTTATTTATTCAGAGTCTGG + Intronic
1020872436 7:13648729-13648751 TTCCTTTAGTATACAGTCTCTGG + Intergenic
1023732556 7:43206026-43206048 CTCCATAAGTATACATTGTCTGG + Intronic
1024164854 7:46720761-46720783 CTGTTTATGCATACAGTGTCTGG + Intronic
1030581002 7:111355381-111355403 CTTTTTATTTATACAGTATCTGG - Intronic
1031236025 7:119178057-119178079 CTCCTTATCTGTGCAGTGTCTGG + Intergenic
1033282720 7:140017404-140017426 CTCCTTAGGAATTCAGTGTGTGG - Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1037303623 8:17481499-17481521 CTGCTTATGTTTAAAGTGTGTGG + Intergenic
1040468080 8:47713749-47713771 TTCTTTATGTATCCAGTGTCTGG - Intronic
1042907108 8:73783369-73783391 CTAATTCTGTATACAGTGTTAGG + Intronic
1044264830 8:90169216-90169238 TCCCTTAAGGATACAGTGTCTGG + Intergenic
1044462032 8:92457035-92457057 CTCCTTTTGGATATAGGGTCTGG + Intergenic
1044873625 8:96643630-96643652 CTCCTTATCTGTACAGTGGGGGG + Intergenic
1046308411 8:112400480-112400502 CTCCTGATGGATGCAGTGTAAGG + Intronic
1049525555 8:143124791-143124813 ATGCATATGTATACAGTGTGAGG - Intergenic
1050458911 9:5860414-5860436 ATCTTTATGTCTCCAGTGTCTGG + Intergenic
1050949894 9:11575268-11575290 ATACTTATATATAAAGTGTCTGG - Intergenic
1051236735 9:15008295-15008317 CTCCTAATGTCTGCAGTGTGAGG + Intergenic
1051308294 9:15740209-15740231 TTACTTATGTATAAAATGTCAGG + Intronic
1055362400 9:75507143-75507165 CCCTTTTTGTATACAGTGTAAGG + Intergenic
1059138758 9:111832423-111832445 CTCAATATATATAAAGTGTCTGG + Intergenic
1187556352 X:20355989-20356011 CTCCTTAATTATACAGAATCTGG - Intergenic
1188916812 X:35921375-35921397 TTCCTTAATTTTACAGTGTCTGG - Intronic
1189381119 X:40503014-40503036 CTCCTTGTGCCTACAGGGTCTGG + Intergenic
1195258844 X:103113902-103113924 CTGCTTAGGGATACAGTGGCAGG + Intergenic
1197418972 X:126213509-126213531 CTCCATTTGTATACAGTATTTGG - Intergenic
1197515354 X:127421291-127421313 CTCCTTATGTGTTGAGTCTCTGG + Intergenic
1197724826 X:129769241-129769263 CACCTTGTGTGGACAGTGTCTGG + Exonic