ID: 908973634

View in Genome Browser
Species Human (GRCh38)
Location 1:69868998-69869020
Sequence GCAGCATTTAAGTTAAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908973634_908973636 15 Left 908973634 1:69868998-69869020 CCTCATTTTAACTTAAATGCTGC No data
Right 908973636 1:69869036-69869058 TTCAATATAGTCTTATTCTGTGG No data
908973634_908973637 22 Left 908973634 1:69868998-69869020 CCTCATTTTAACTTAAATGCTGC No data
Right 908973637 1:69869043-69869065 TAGTCTTATTCTGTGGCACCAGG 0: 1
1: 0
2: 0
3: 13
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908973634 Original CRISPR GCAGCATTTAAGTTAAAATG AGG (reversed) Intronic
No off target data available for this crispr