ID: 908981321

View in Genome Browser
Species Human (GRCh38)
Location 1:69962806-69962828
Sequence GTCCTCCAGTAGGCCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908981321_908981332 20 Left 908981321 1:69962806-69962828 CCCACTGGGGCCTACTGGAGGAC 0: 1
1: 0
2: 4
3: 14
4: 137
Right 908981332 1:69962849-69962871 GAATCAGGAAAAACGACTAACGG 0: 1
1: 10
2: 203
3: 1165
4: 1619
908981321_908981328 -10 Left 908981321 1:69962806-69962828 CCCACTGGGGCCTACTGGAGGAC 0: 1
1: 0
2: 4
3: 14
4: 137
Right 908981328 1:69962819-69962841 ACTGGAGGACAGAGGGTGGGAGG 0: 1
1: 8
2: 55
3: 327
4: 1763
908981321_908981329 -7 Left 908981321 1:69962806-69962828 CCCACTGGGGCCTACTGGAGGAC 0: 1
1: 0
2: 4
3: 14
4: 137
Right 908981329 1:69962822-69962844 GGAGGACAGAGGGTGGGAGGCGG No data
908981321_908981330 -6 Left 908981321 1:69962806-69962828 CCCACTGGGGCCTACTGGAGGAC 0: 1
1: 0
2: 4
3: 14
4: 137
Right 908981330 1:69962823-69962845 GAGGACAGAGGGTGGGAGGCGGG 0: 1
1: 4
2: 63
3: 483
4: 3216
908981321_908981331 5 Left 908981321 1:69962806-69962828 CCCACTGGGGCCTACTGGAGGAC 0: 1
1: 0
2: 4
3: 14
4: 137
Right 908981331 1:69962834-69962856 GTGGGAGGCGGGAGAGAATCAGG 0: 2
1: 56
2: 783
3: 1509
4: 2132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908981321 Original CRISPR GTCCTCCAGTAGGCCCCAGT GGG (reversed) Intronic
902962660 1:19975933-19975955 GTCCTCCAGAAGCTCCTAGTTGG + Intronic
904299735 1:29546609-29546631 GCCCTCCTGAAGGCCCCAGCTGG + Intergenic
904405539 1:30285874-30285896 GCCCTCCTGCAGGCCCCAGCTGG - Intergenic
904458525 1:30661838-30661860 GCCCTCCTGCAGGCCCCAGCTGG - Intergenic
906798307 1:48714782-48714804 GTCCTCCAGCAGGCCCTGCTTGG + Intronic
908882023 1:68743197-68743219 CAGCTCCACTAGGCCCCAGTAGG - Intergenic
908981321 1:69962806-69962828 GTCCTCCAGTAGGCCCCAGTGGG - Intronic
910307872 1:85787374-85787396 CTCCACCAACAGGCCCCAGTGGG + Intronic
910763972 1:90762193-90762215 GACCTCCAGGAGGCACCAGTTGG + Intergenic
912358627 1:109076054-109076076 GTCCTCCCGCAGGCCGCAGAGGG - Intergenic
916583295 1:166127523-166127545 CACATACAGTAGGCCCCAGTTGG - Intronic
918276624 1:182959209-182959231 ATCTTCCAGCAGGCCGCAGTAGG + Intergenic
922201206 1:223403003-223403025 GTCCTACAGTAGGCCTCTTTGGG - Intergenic
922466433 1:225848100-225848122 GTCCTCCACTAGGCTCCAAGAGG - Intronic
922764906 1:228151669-228151691 GTGCAGCAGTAGGCCCCACTGGG - Intronic
924610601 1:245570434-245570456 ATCATCCAGAAAGCCCCAGTTGG - Intronic
1063219175 10:3950464-3950486 ACCCTCGAATAGGCCCCAGTGGG - Intergenic
1077013427 11:389941-389963 GTCCTCCAGCGGTCCCCTGTGGG - Intergenic
1077106463 11:844535-844557 GTCCTCAGGTAGAGCCCAGTCGG - Exonic
1077842861 11:5994011-5994033 GTCTTCCAGCAGGCTGCAGTAGG + Intergenic
1079339475 11:19600122-19600144 GTCCTTCAGAGGGCCCCTGTGGG - Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1082850032 11:57756045-57756067 TACCTCCAGTTGGCCTCAGTGGG - Intronic
1083221993 11:61258706-61258728 GGCCCCCAGCAGCCCCCAGTGGG - Exonic
1084647181 11:70465317-70465339 TTTCTCCGGTAGGCCCCAGGAGG - Intergenic
1085350217 11:75793425-75793447 GTCACCCAGTGGGCCCCAGGTGG - Intronic
1087627313 11:100609980-100610002 TCCCTCCAACAGGCCCCAGTGGG - Intergenic
1095081244 12:38002076-38002098 TTTCTCCCGTAGGCCCCAATGGG - Intergenic
1096229456 12:49889072-49889094 GTCCCCCAGCAGGCCCCATGGGG - Intronic
1096532751 12:52252273-52252295 GCCCTCCAGCAGGCGCCTGTAGG + Intronic
1096537906 12:52287113-52287135 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1096540865 12:52306247-52306269 GCCCTCCAGCAGGCGCCTGTAGG - Exonic
1096542507 12:52315904-52315926 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1096549373 12:52362262-52362284 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1096552184 12:52380374-52380396 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1098590811 12:72209250-72209272 GTCCTCAAGAAGACCCCAGCTGG - Intronic
1101777859 12:107810007-107810029 GTCATCCATCAGGCCTCAGTTGG + Intergenic
1102911048 12:116714394-116714416 CATCTCCAGGAGGCCCCAGTTGG + Exonic
1103912412 12:124359766-124359788 TTCCTCCAGTTGGGCCCAGGGGG + Intronic
1104518287 12:129448382-129448404 ACCCTCCAGTAGGCCCCAGTGGG + Intronic
1105404229 13:20120128-20120150 CTCCTGCACTAGGCCCCAGTAGG + Intergenic
1107043603 13:35973460-35973482 GTCCTCCTATAGGGCCCACTGGG + Intronic
1109389737 13:61677863-61677885 ATCCCCCAACAGGCCCCAGTGGG + Intergenic
1111580145 13:90211825-90211847 GTCCTCCATTATGCCACAATAGG + Intergenic
1111581760 13:90231526-90231548 GTCTTCCAGTGGGCTGCAGTAGG - Intergenic
1112070134 13:95841033-95841055 GCCCTCCAATAGGCCCCAGTGGG - Intronic
1114516288 14:23302104-23302126 CTCCTCCAGTCGGCCGCAGCGGG - Intronic
1118695445 14:68380420-68380442 GTGCCCCAGCAGGCCCCAGATGG + Intronic
1122275310 14:100587843-100587865 GCCCTGCTGTAGGCCCCAGGGGG + Intergenic
1123933242 15:25181951-25181973 GACCTGCAGTAGGACACAGTCGG + Intergenic
1125816766 15:42591769-42591791 GTCCTCTAGTAGTCCCTAGTTGG - Intronic
1128454471 15:67824884-67824906 ATCCTGCAGTTGGCCCGAGTGGG + Exonic
1130059187 15:80557436-80557458 ACCCTCAAGTAGACCCCAGTGGG - Intronic
1130662232 15:85839795-85839817 CTCCTGCACTAGGCCCCAGCAGG + Intergenic
1132087896 15:98922977-98922999 GTCCTTTAGTAGGCCTCAGGTGG + Intronic
1132695766 16:1201123-1201145 GTCCTCTCATAGGCCCCAGTGGG + Intronic
1135993342 16:27230658-27230680 GTCCTCCTGAGGGCCCCAGCAGG + Intronic
1137931732 16:52594853-52594875 TTCCACCAGTAGGCACCAGATGG - Intergenic
1137962613 16:52898094-52898116 GTCTTCCAGTGGTCCCTAGTGGG + Intergenic
1141388633 16:83646087-83646109 GTCCCACACTAGGGCCCAGTGGG - Intronic
1146837927 17:36127129-36127151 AACCTCCAGGAGGCCCCAGATGG + Intergenic
1148850449 17:50551977-50551999 GTCCTCCAGGAAGCCCCAGCAGG - Exonic
1149661422 17:58336098-58336120 GCCCTCCAGTAAGCTACAGTTGG + Intergenic
1151548702 17:74808901-74808923 GTGCTGCAGGAGCCCCCAGTGGG + Intronic
1152400598 17:80064329-80064351 GTTCTACAGGACGCCCCAGTTGG + Intronic
1154061683 18:11067314-11067336 TTCCTCCATTAGGCCCTATTAGG + Intronic
1156511790 18:37642931-37642953 GTCCTCCAAAAGTCCCCAGTTGG - Intergenic
1158224195 18:55183477-55183499 ATCCTCCAGTAGGCCACCATGGG - Intergenic
1158932473 18:62335075-62335097 GTGCTCCAGTTGGGTCCAGTTGG + Intronic
1160991045 19:1860451-1860473 CTCCTCCAGTGTGCCTCAGTTGG + Intronic
1161884158 19:6980670-6980692 GTTCTCCAGTGGACCCCAGCTGG - Intergenic
1163295750 19:16411460-16411482 TTTCTCCCGTAGGCGCCAGTAGG - Intronic
1163859978 19:19737764-19737786 CACCTTCACTAGGCCCCAGTGGG + Intergenic
1164761282 19:30730173-30730195 TGTCTCCTGTAGGCCCCAGTGGG + Intergenic
1168489342 19:56795289-56795311 TTCCACCACAAGGCCCCAGTAGG + Intronic
1168571215 19:57472230-57472252 GTCCTCCAGAAGGCCCAGGTAGG - Exonic
925366342 2:3314664-3314686 GTCCTTCAGAAGGTCCCAGGGGG - Intronic
926800584 2:16656584-16656606 CTCCTCCAGAAGGACACAGTGGG + Intronic
927973329 2:27319640-27319662 GTGATCCAGTAGGCCCCACCTGG - Intronic
928166433 2:28975913-28975935 CTCCACCAGCAGGGCCCAGTGGG - Intronic
929442101 2:41972648-41972670 CTACTCCATTAGGCCCCAGCAGG + Intergenic
929626725 2:43416522-43416544 GTCCTACAGTAGGCTGTAGTAGG - Intronic
930099645 2:47593113-47593135 CTCCTGCACTAGGCCCCTGTAGG + Intergenic
932401654 2:71484909-71484931 GTCCTCCCATTGGCCCCTGTGGG + Intronic
932570580 2:72936391-72936413 GTCATCCTTTTGGCCCCAGTGGG + Intergenic
933157037 2:78987967-78987989 GGCCTCCTGTAGGCACCAGGGGG - Intergenic
936508690 2:113128578-113128600 ATCCTCCTGGAGGCCCCAGCAGG + Intronic
937289482 2:120773638-120773660 GCCCTCAGGTAGCCCCCAGTTGG + Intronic
939858791 2:147393128-147393150 TCCCTCCAGTAGGCCCCTCTAGG + Intergenic
946790959 2:223300038-223300060 GTCCTCCAGTCTGTCCCAATGGG + Intergenic
947117633 2:226789506-226789528 GGCCTCCTATAGTCCCCAGTTGG + Intronic
948718330 2:239880625-239880647 GTGCTCCAGTAGGGCCCTGGGGG - Intergenic
1169455402 20:5748271-5748293 CTCCTCCACTAGGCCCCAGCAGG + Intergenic
1170386930 20:15829550-15829572 ATTCTCAAGTAGGCTCCAGTTGG + Intronic
1170664417 20:18374526-18374548 ACCCTCCAATAGGCCCCAGTGGG - Intergenic
1172904598 20:38359703-38359725 GGACTCCAGTAGGGCCCAGTTGG + Intronic
1173331122 20:42077238-42077260 GGCCTCTAGAAGGCCACAGTAGG - Exonic
1173927708 20:46793031-46793053 GTCACCCAGAGGGCCCCAGTGGG - Intergenic
1173949330 20:46978126-46978148 GGCCTCCCGTTGGCCCCAGGTGG + Intronic
1174349660 20:49957875-49957897 GTCTTCCAGCAGGCGGCAGTAGG - Intergenic
1175055403 20:56193116-56193138 GTCCTTCTGGAGGCTCCAGTGGG + Intergenic
1178050490 21:28741558-28741580 ACCCTCCACTAGGCCCCAGCGGG + Intergenic
1179226059 21:39454541-39454563 CTCTTCCAGAAGGCCACAGTGGG + Intronic
1182491216 22:30673358-30673380 GGACTCCAGTTGGCCCCAGTTGG + Intergenic
1182689665 22:32150078-32150100 GTCATCCAGCAGGACTCAGTTGG + Intronic
1184408134 22:44311731-44311753 GTCCTCCAGGGGGCCACACTGGG + Intronic
1184806910 22:46800960-46800982 GTCCTCCAGAATGCTCCAGGTGG - Intronic
949240867 3:1869958-1869980 ACCCTCCAATTGGCCCCAGTGGG - Intergenic
952077003 3:29709036-29709058 GGACTTCAGCAGGCCCCAGTGGG - Intronic
953636650 3:44670335-44670357 GTCCTCCAGAAGGCCACAGCAGG - Intergenic
954696430 3:52429707-52429729 CTCCTCCAGTAGGCTCCTGGGGG - Intergenic
955275815 3:57545935-57545957 GGGCTCCAGTAGGTTCCAGTGGG + Intergenic
955485157 3:59427807-59427829 TTCCTCCTGTAGGCTCCAGGAGG - Intergenic
955799706 3:62672859-62672881 GCCCTCTAGGAGGCCCCTGTGGG - Intronic
956719072 3:72102371-72102393 GTCTCCCCGTAGTCCCCAGTGGG - Intergenic
958623841 3:96599828-96599850 ACCCTTCAGTAGGCCCCATTGGG - Intergenic
960165521 3:114396998-114397020 GTTCATTAGTAGGCCCCAGTTGG + Intronic
964616577 3:158672738-158672760 CTCCTCCAGTAGGAACCAGCAGG - Intronic
969127937 4:4967832-4967854 GTCCTACAGCAGGCCTCAGCAGG - Intergenic
969631847 4:8343503-8343525 GTCCTCCACTCATCCCCAGTGGG - Intergenic
970824115 4:20252780-20252802 ATTCTCCAGTACGCCCCAGCAGG + Intergenic
973069649 4:45841675-45841697 TTCCTTCCGTAGGCTCCAGTGGG - Intergenic
973971803 4:56220461-56220483 TTCTTCCAGCAGGCCCCAGCAGG - Intronic
975536813 4:75459770-75459792 ATCCTCCAGCAGACACCAGTTGG - Intergenic
980332819 4:131431029-131431051 CTCCTCCACTAAGCCCCAATAGG - Intergenic
980342543 4:131568989-131569011 GTCCTGCAGGAAGCTCCAGTGGG + Intergenic
981135970 4:141212113-141212135 GTCATCCAGTGGTCTCCAGTGGG - Intronic
991544385 5:67765294-67765316 GGCCTCCAGTGAGCCCCAGATGG - Intergenic
994154434 5:96486989-96487011 GTCCACAAGTGGGCCTCAGTTGG - Intergenic
995789747 5:115872636-115872658 TTTCTCAAGTAGGCCCCAGGAGG - Intronic
998079255 5:139261049-139261071 GTCCTCAAGGAGCTCCCAGTTGG - Intronic
1002107555 5:176887596-176887618 CTCCTCCAGCAGGCGCCGGTGGG + Exonic
1004150235 6:13112036-13112058 ACCCTCCATTAGGCCCCAGTGGG + Intronic
1022226829 7:28371784-28371806 GTCCTCCAGTAGTCTCCAGTGGG + Intronic
1025933961 7:66019086-66019108 ATCGTCCTGTAGGCCCCAGCTGG + Intergenic
1026807230 7:73435995-73436017 ATCCTCCACTAGGACCCTGTGGG - Exonic
1029346252 7:99980827-99980849 GTCCTCCAGGAGACCCGAGATGG + Intergenic
1033411169 7:141119150-141119172 GTCCCCCAGCAGTCTCCAGTGGG - Intronic
1036985188 8:13521234-13521256 CCCCTCCAACAGGCCCCAGTGGG - Intergenic
1037456303 8:19067777-19067799 GTCACCCAGTTGGCTCCAGTGGG - Intronic
1049640596 8:143713444-143713466 GTCCACCAGGTAGCCCCAGTAGG + Intronic
1053006280 9:34606942-34606964 TTCCTCCTGTAGGCCCCAGCTGG + Intergenic
1056846249 9:90040471-90040493 GTCCTCCTTTAGGGCCCAGGAGG - Intergenic
1057739688 9:97700579-97700601 ATCCTCCAGCAGGCAGCAGTAGG - Intergenic
1058110769 9:101029065-101029087 GTCCTCCAGTGCGCCCTACTGGG - Exonic
1060275068 9:122176198-122176220 TTCCTCCAGTAGCATCCAGTGGG - Intronic
1062645638 9:137546772-137546794 TTCCTCGAGCAGGCCCCTGTGGG - Intronic
1187733938 X:22285129-22285151 TTTCTCCAGGAGGCCCCAGCAGG + Intergenic
1188261162 X:28025843-28025865 ACCCTCCAATGGGCCCCAGTGGG - Intergenic
1188414772 X:29919120-29919142 GTACTCTAGAATGCCCCAGTGGG + Intronic
1190901373 X:54677049-54677071 CTCCTCCAATAGGCCCCAGTGGG - Intergenic
1194495840 X:94615897-94615919 CAGCTCCACTAGGCCCCAGTGGG + Intergenic
1195412181 X:104579587-104579609 ACCCTCAAGTAGGCCCCAGCGGG - Intronic
1199694519 X:150334512-150334534 GCCCTCCAGCAGACCCCAGAAGG - Intergenic
1202372897 Y:24210330-24210352 GGCCTCCTGCAGGGCCCAGTGGG + Intergenic
1202497885 Y:25459790-25459812 GGCCTCCTGCAGGGCCCAGTGGG - Intergenic