ID: 908981321

View in Genome Browser
Species Human (GRCh38)
Location 1:69962806-69962828
Sequence GTCCTCCAGTAGGCCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908981321_908981330 -6 Left 908981321 1:69962806-69962828 CCCACTGGGGCCTACTGGAGGAC 0: 1
1: 0
2: 4
3: 14
4: 137
Right 908981330 1:69962823-69962845 GAGGACAGAGGGTGGGAGGCGGG 0: 1
1: 4
2: 63
3: 483
4: 3216
908981321_908981331 5 Left 908981321 1:69962806-69962828 CCCACTGGGGCCTACTGGAGGAC 0: 1
1: 0
2: 4
3: 14
4: 137
Right 908981331 1:69962834-69962856 GTGGGAGGCGGGAGAGAATCAGG 0: 2
1: 56
2: 783
3: 1509
4: 2132
908981321_908981332 20 Left 908981321 1:69962806-69962828 CCCACTGGGGCCTACTGGAGGAC 0: 1
1: 0
2: 4
3: 14
4: 137
Right 908981332 1:69962849-69962871 GAATCAGGAAAAACGACTAACGG 0: 1
1: 10
2: 203
3: 1165
4: 1619
908981321_908981328 -10 Left 908981321 1:69962806-69962828 CCCACTGGGGCCTACTGGAGGAC 0: 1
1: 0
2: 4
3: 14
4: 137
Right 908981328 1:69962819-69962841 ACTGGAGGACAGAGGGTGGGAGG 0: 1
1: 8
2: 55
3: 327
4: 1763
908981321_908981329 -7 Left 908981321 1:69962806-69962828 CCCACTGGGGCCTACTGGAGGAC 0: 1
1: 0
2: 4
3: 14
4: 137
Right 908981329 1:69962822-69962844 GGAGGACAGAGGGTGGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908981321 Original CRISPR GTCCTCCAGTAGGCCCCAGT GGG (reversed) Intronic