ID: 908983688

View in Genome Browser
Species Human (GRCh38)
Location 1:69990265-69990287
Sequence CTCTTCAGTATTTCTTAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 2, 1: 0, 2: 1, 3: 23, 4: 278}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908983686_908983688 10 Left 908983686 1:69990232-69990254 CCAACTTAATTTGGTAGAAATTA No data
Right 908983688 1:69990265-69990287 CTCTTCAGTATTTCTTAGTTGGG 0: 2
1: 0
2: 1
3: 23
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908983688 Original CRISPR CTCTTCAGTATTTCTTAGTT GGG Intronic
901360826 1:8698265-8698287 TTCTTCAGGATTTCTTAGTTGGG - Intronic
902848139 1:19128614-19128636 CTGTTCTTTAATTCTTAGTTTGG - Intronic
902929245 1:19718796-19718818 CCCTGGTGTATTTCTTAGTTTGG + Intronic
905650948 1:39656657-39656679 CCCTGCAGTTTTTCTTAATTAGG + Intergenic
905744361 1:40401491-40401513 CTCCTCAATATTTATTTGTTTGG + Intronic
905813850 1:40932482-40932504 CTTTTCTGTATTCCTTAGTCAGG + Intergenic
906461542 1:46038284-46038306 CTCTTCCTTGTTTCTTATTTCGG - Intergenic
907028106 1:51142263-51142285 CTCTTCAGTCTTCCTTATTTAGG + Intronic
908983688 1:69990265-69990287 CTCTTCAGTATTTCTTAGTTGGG + Intronic
908983825 1:69992351-69992373 CTCTTCAGTATTTCTTAGTTGGG + Intronic
909135495 1:71794323-71794345 CTCTTTTATTTTTCTTAGTTAGG - Intronic
909579182 1:77213796-77213818 GTCTTCTCTTTTTCTTAGTTTGG - Intronic
909919534 1:81364013-81364035 TTCTTCTGTATTTCTTTGTGAGG + Intronic
910329341 1:86052230-86052252 TTCTTCAGTATTTGTTATTATGG - Intronic
910407259 1:86901940-86901962 TTCTTCAGTCCTTCTGAGTTTGG + Intronic
910693475 1:89988479-89988501 CTCTTCAGTTTTCCTTGTTTGGG + Intergenic
911199258 1:95028135-95028157 CACATCAGTATTTGTTAGTTTGG + Intronic
912031272 1:105247658-105247680 GTCTTCTTTATTTCTTGGTTTGG + Intergenic
912405184 1:109431834-109431856 CTCTGCAGTATCTTTCAGTTTGG - Intergenic
913165955 1:116184992-116185014 CTCTACAGTACTTCAGAGTTGGG + Intergenic
914251470 1:145925323-145925345 CTGGTCAGTATTTCTTTTTTGGG - Intergenic
914350729 1:146837585-146837607 CTCTTCAGTATTTCCTTAATGGG + Intergenic
915239189 1:154507709-154507731 CCTTTCATTATTTCATAGTTTGG + Intronic
916018498 1:160772265-160772287 CTTTTCAGTTTTTCTTAGGCTGG + Intergenic
916500924 1:165386058-165386080 ATCCTCGGTGTTTCTTAGTTTGG - Intergenic
916555882 1:165893890-165893912 CTTTTTAGTATTTATCAGTTAGG + Intronic
918833839 1:189434056-189434078 ATCTTCAATATTTCTGAGCTTGG + Intergenic
919172852 1:193977710-193977732 CATTTAAGTATTTTTTAGTTAGG - Intergenic
919479369 1:198068641-198068663 GTCTTAAGTTTTTCTTAGATAGG + Intergenic
919938204 1:202268780-202268802 CTTTTGAGGATTTTTTAGTTTGG + Intronic
920120894 1:203657231-203657253 CTGATCAGTCTTTCTTATTTAGG + Intronic
921106387 1:211984150-211984172 CCCTTCAGTGTTTTTAAGTTAGG + Intronic
923515142 1:234690949-234690971 CTCTTTAGTAATTCTGAGATTGG - Intergenic
924046038 1:240031760-240031782 CTCCTTAGTATTTTTTAGTAGGG - Intronic
924119099 1:240778451-240778473 CTCTTAATTTTTTCTTAATTGGG + Intronic
1063791539 10:9454245-9454267 CTCATCAGTAATTCTAATTTTGG + Intergenic
1063864868 10:10353077-10353099 CACTTCAGGAATTCTCAGTTTGG + Intergenic
1064594750 10:16932341-16932363 CACGTCAGTATTTCTCAGTGTGG - Intronic
1064829804 10:19450110-19450132 CTCTTGAGTCTTTTTGAGTTGGG + Intronic
1065034855 10:21627506-21627528 CTATTCAGTATTTCCCAGTTTGG + Intronic
1065219688 10:23483667-23483689 CTGTTCTGTTTTTCATAGTTTGG + Intergenic
1068039382 10:51803620-51803642 CTCTTCTGTCTTTCTATGTTTGG + Intronic
1068080093 10:52309139-52309161 CTCTTCAGCATTTCTAAGACTGG + Intergenic
1069447754 10:68489578-68489600 ATCTTGAGTAATGCTTAGTTGGG - Intronic
1070220326 10:74435890-74435912 TTCTTTAGTATTTCTTGGTAAGG - Intronic
1070814144 10:79312649-79312671 CTCGTCAGGATTTGTGAGTTCGG - Exonic
1071065927 10:81636137-81636159 CTCTTCCGTATATCTTAATATGG - Intergenic
1072072715 10:91934901-91934923 CTTTTCAGTATTACATAGTTGGG + Intronic
1072441209 10:95457151-95457173 CTCTTTAACATTTGTTAGTTTGG - Intronic
1073535183 10:104269883-104269905 CTCTTCAATATTTATTAGCTGGG - Intronic
1074091642 10:110265011-110265033 CTATTTAGGATTTTTTAGTTCGG + Intronic
1074943021 10:118253521-118253543 TCATTCAGTATTTATTAGTTTGG + Intergenic
1075019331 10:118938957-118938979 CTTTTGCCTATTTCTTAGTTGGG - Intergenic
1078095838 11:8296605-8296627 CTCTCCAGTATTTCTGCCTTGGG - Intergenic
1078539786 11:12204242-12204264 CTCTGCAGTGTCTCATAGTTGGG + Exonic
1082109128 11:48253981-48254003 CTTTTCTGCTTTTCTTAGTTGGG + Intergenic
1086042764 11:82498837-82498859 TCCTTCAGTATTTCTTATTTTGG - Intergenic
1087989483 11:104730438-104730460 CTCTTCTGTATTATTTAGGTGGG - Intergenic
1089771207 11:120804496-120804518 CTCTTCCCTCTCTCTTAGTTTGG + Intronic
1090038781 11:123272057-123272079 CTCTTTAGTATTTCTTACTCTGG - Intergenic
1091906327 12:4192342-4192364 TTTTTCAGTATTTTTTAGTAAGG + Intergenic
1093149135 12:15601340-15601362 CTCTTTAGTATTGCTTAATGTGG - Intergenic
1093563742 12:20577137-20577159 CTCTTCTGTAATTCCTTGTTTGG - Intronic
1094055694 12:26267504-26267526 CTGCTCAGTATTTGTTAATTTGG - Intronic
1094072409 12:26432229-26432251 CTCTTTAGTATCTTTTAATTTGG + Intronic
1094676306 12:32623635-32623657 CTCTTCAGAATTTTTCAATTTGG + Intronic
1095263112 12:40121078-40121100 CTCATCAGTATTTTGGAGTTTGG + Intergenic
1095453223 12:42353241-42353263 GTTTTCAGTATTCCTTAGCTAGG + Intronic
1097623343 12:61968320-61968342 CTGTTCAGTTTTTCTCAGCTTGG - Intronic
1097704403 12:62852521-62852543 TTCTTTATTATTTCTTAGTCTGG - Intronic
1097959482 12:65518574-65518596 GTCTTAAGTTTTTCATAGTTCGG - Intergenic
1099079033 12:78152087-78152109 CTCTTTAGTGTTTCTTTATTTGG + Intronic
1099702157 12:86099307-86099329 TTCCTCACTATTTCATAGTTTGG + Intronic
1100052694 12:90469504-90469526 TTCTTCAGCATTTGTTAGTCTGG + Intergenic
1101098272 12:101366395-101366417 CTCTTCTGTATCTCATGGTTTGG + Intronic
1101220640 12:102635601-102635623 CTCTTAAGAACTTATTAGTTGGG + Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1103451841 12:121034663-121034685 CTCTTCCCTGTTTCTTAGCTGGG + Intronic
1103775867 12:123365674-123365696 CTCTTCAGTATTCATTAAGTGGG - Intergenic
1104220845 12:126783729-126783751 CTCTGTAATATTTCTTAGCTGGG + Intergenic
1104402205 12:128485487-128485509 CTCTTAAGTGGTTCTTAATTTGG + Intronic
1106675648 13:31955372-31955394 CACATCAGGGTTTCTTAGTTGGG + Intergenic
1106702323 13:32243754-32243776 ATCTTCAGTTCTTCATAGTTAGG + Intronic
1108497349 13:51038567-51038589 CTCTTCAGTATTCTTTGGCTTGG - Intergenic
1109166884 13:59046597-59046619 ATTTTCAGTATGTTTTAGTTAGG + Intergenic
1109250874 13:60019532-60019554 CCCTTCAGCATTTCCTAGTAGGG + Intronic
1110050040 13:70885362-70885384 CTATTCAGTTTTAATTAGTTTGG - Intergenic
1111359503 13:87157131-87157153 CTCTTCTATATTTCCTTGTTGGG - Intergenic
1111801631 13:92988346-92988368 CTCTTCAGTATATCATAGAAAGG - Intergenic
1113452552 13:110421803-110421825 CTCATCTTTATTTCTTGGTTAGG - Intronic
1113555830 13:111233219-111233241 CTCTTCAGTGTTCCTGATTTGGG - Exonic
1113581574 13:111433716-111433738 CCCTTTATTATTTCTTATTTTGG + Intergenic
1115822715 14:37228780-37228802 GTTTTCAGTATTTCTTCTTTTGG - Intronic
1116143102 14:41026126-41026148 ATCTTCAGGTTTTATTAGTTGGG + Intergenic
1116268159 14:42723070-42723092 TTCTTTAGCATTTCTTAGGTAGG - Intergenic
1117282292 14:54253117-54253139 GGCTTCACTATTTGTTAGTTTGG - Intergenic
1117559862 14:56926058-56926080 CTCTTCAGTGTTTCTAATTTTGG + Intergenic
1117889090 14:60398819-60398841 CTGGTCAGTATTTCTTTTTTGGG + Intronic
1119162685 14:72466209-72466231 ATCATCAGTATTTTTTATTTTGG - Intronic
1122120129 14:99548630-99548652 CGCTACAGTATTTCATTGTTGGG - Intronic
1122477456 14:102020760-102020782 CACTTAAGCATTTCTTAGTCTGG - Intronic
1123776316 15:23584176-23584198 CTCCTCAGTTTTACTTGGTTGGG - Intronic
1126183470 15:45808712-45808734 CTCTTTTGAAGTTCTTAGTTGGG + Intergenic
1126958676 15:53964580-53964602 CTCTTTAGAATTTATTAGGTTGG - Intergenic
1127197714 15:56607776-56607798 CCCTTTAGTATTTCTCAGTGTGG + Intergenic
1127925171 15:63532469-63532491 CTTTTCAGTATAACTTAATTAGG + Intronic
1128626039 15:69204945-69204967 CTTTTCAGGATTATTTAGTTTGG - Intronic
1130828908 15:87579719-87579741 CTCTACAGATTTGCTTAGTTTGG - Intergenic
1130846105 15:87747637-87747659 TTCTTGAGCATTTCTTAATTAGG - Intergenic
1132996187 16:2824627-2824649 CTCTCCAGTATGTCTGAATTTGG + Intronic
1133815787 16:9196358-9196380 TTCTTCTGTATTTGTTTGTTTGG - Intergenic
1135115421 16:19719052-19719074 CTACTCAGTATTTGTTACTTAGG + Intronic
1135650199 16:24199564-24199586 CTCTTGAGTATTTGATACTTTGG - Intronic
1137369537 16:47892151-47892173 CTCTTCATTCTCTCTTAGTTAGG + Intergenic
1138178020 16:54920074-54920096 CTCCAAATTATTTCTTAGTTTGG - Intergenic
1138695111 16:58805842-58805864 CTATTCAGTATTACTTGATTTGG + Intergenic
1139195461 16:64913448-64913470 CTCTTTACTCTTTCTTACTTGGG + Intergenic
1139983306 16:70877959-70877981 CTCTTCAGTATTTCCTTAATGGG - Intronic
1140662934 16:77205274-77205296 CTCTTCAGTTTTCCTTAGAGAGG + Intronic
1140705000 16:77619547-77619569 CTCTTCAATATCACTTAGCTTGG + Intergenic
1141260896 16:82453024-82453046 CACTTCAGTATTTTTAATTTTGG - Intergenic
1142781582 17:2185446-2185468 ATCTTAACTATTTCTAAGTTCGG - Intronic
1147950946 17:44107741-44107763 CTCTTCAGTCTTTCTGGGTTTGG - Intronic
1148002351 17:44397324-44397346 CTCTTCTGTGTTTCTAAGCTAGG - Intronic
1150612302 17:66743326-66743348 CTCAACAGTATTTCTTTTTTTGG - Intronic
1151795534 17:76342769-76342791 CTATTCAGTCTTCTTTAGTTTGG - Intronic
1152405166 17:80093953-80093975 CTTTTTAGTGTTTCTTAGTGTGG + Intronic
1155243005 18:23881389-23881411 CTCTTCAGTATATCATTGTTAGG + Intronic
1157000277 18:43514657-43514679 CTCTGCAGTTTTTCTTACCTTGG + Intergenic
1157060954 18:44289764-44289786 GCCTTCAATATCTCTTAGTTTGG - Intergenic
1157124378 18:44942120-44942142 CTTTTCAGAATTTGTTAGTGAGG + Intronic
1157555325 18:48609798-48609820 ATGCTCAGTATGTCTTAGTTGGG + Intronic
1158337643 18:56431221-56431243 CTCTTGAGTATATCTTTTTTGGG - Intergenic
1159196990 18:65129130-65129152 CTTTTCAGTAAGTCTTAATTTGG + Intergenic
1160210322 18:76872804-76872826 TTCTTCTGTATTTCTTGATTTGG + Intronic
1161459327 19:4387237-4387259 CTCTTCTGTATTTCTTATTCTGG + Intronic
1165240541 19:34463264-34463286 GTTTTCAGAATTTCTCAGTTTGG + Intronic
1165991435 19:39817084-39817106 CTCATGAATATTTATTAGTTGGG - Intergenic
925736650 2:6969620-6969642 CTCTGCAGTATTTCAGATTTTGG - Intronic
925784858 2:7422040-7422062 CTCTTGAGAATTTATAAGTTAGG + Intergenic
929173434 2:38954519-38954541 CTTTACAGTATTTCTCAGTTGGG - Intronic
930189451 2:48442455-48442477 CTTTTCAGTTTTTATTACTTTGG - Intronic
930327534 2:49938900-49938922 CATGTCAGTATCTCTTAGTTTGG - Intronic
930506315 2:52286220-52286242 CTTTTCATAATTTCTTATTTAGG - Intergenic
931661744 2:64571280-64571302 TTTTTCAGTATTTCTGAGGTAGG + Intronic
931736110 2:65196276-65196298 TTCTTCATTATTTCTTTTTTTGG + Intergenic
932889001 2:75574169-75574191 TGCTTCAGAATTTCTTAGGTTGG - Intergenic
932966080 2:76476146-76476168 CTATTCAGTTTTAATTAGTTTGG - Intergenic
932989982 2:76775095-76775117 CTCTTCATGATTTCTTTGATTGG + Intronic
933380924 2:81544203-81544225 CTCTTCATTATTTGTTAATTTGG + Intergenic
937347957 2:121139001-121139023 TACATCAGTAGTTCTTAGTTGGG + Intergenic
937398900 2:121564409-121564431 TTCTTCAGTGGTTCTAAGTTAGG - Intronic
937940726 2:127283725-127283747 CACATCAGTATTTTTTATTTTGG + Intronic
939878936 2:147608287-147608309 CTTTTCAGTCATTCATAGTTAGG - Intergenic
939925307 2:148166312-148166334 CTCTTCATTATTTGTCAGATTGG + Intronic
941168381 2:162108147-162108169 ATCTTCAGTATTTCTTAGGATGG + Intergenic
941345315 2:164361511-164361533 CTCTTCAGTTTTTTTTTTTTTGG - Intergenic
942199162 2:173553709-173553731 CACTTTATTATTTCTTAGTGTGG + Intergenic
942962214 2:181844658-181844680 CTTTTGAGTAGTTCTCAGTTTGG + Intergenic
944099315 2:196005372-196005394 CTATTCAATATTTTTTTGTTTGG - Intronic
944473311 2:200078764-200078786 CTCTTCAGTATCTGTTACTAGGG - Intergenic
947993271 2:234504353-234504375 CTTTTTAGTATTTTTTAATTAGG + Intergenic
948512830 2:238482200-238482222 CTCATCTGTATTTTTTATTTTGG - Intergenic
1177096361 21:16838922-16838944 ACCTACAGTATTTCTCAGTTCGG - Intergenic
1177156837 21:17509294-17509316 CTGTGCACTATTTCTTAGCTTGG + Intergenic
1177373173 21:20233210-20233232 CTCTACAGTATATTTTAGTCAGG + Intergenic
1177498964 21:21925778-21925800 CTATTCAGTATTTCTATGTGAGG + Intergenic
1177715163 21:24830957-24830979 CTGTACAGTATATATTAGTTTGG + Intergenic
1178049029 21:28728499-28728521 CTCTTAAGTATGTCTTCGGTAGG + Intergenic
1182939218 22:34258509-34258531 CTCTTCATTAGTGTTTAGTTTGG + Intergenic
1184550469 22:45201751-45201773 CTCTTCTGTATATCTTTTTTTGG - Intronic
1184669595 22:46005742-46005764 CTCTTCAGTTTCCCTCAGTTAGG + Intergenic
949469965 3:4384166-4384188 CTGCTTAGTATTTCTTAGTATGG + Intronic
951412420 3:22381064-22381086 CTTTTCAGTAGCTCTTATTTTGG - Intergenic
953062341 3:39437734-39437756 CTCTTTGGCATTTTTTAGTTGGG + Intergenic
955542099 3:59988323-59988345 CTCTTTGATATTTCTTTGTTTGG + Intronic
956224213 3:66937605-66937627 CTCATTAGTATTTCTTATATTGG + Intergenic
956433771 3:69213345-69213367 CTCATGAGTATTTCTTACTCTGG + Intronic
956986298 3:74704878-74704900 TTCTTCACTACTTCTTAGCTAGG + Intergenic
957214224 3:77298430-77298452 CTCTCAAGAATTCCTTAGTTTGG - Intronic
957400532 3:79707048-79707070 CTCTACAGTCTTTCTTAGAAGGG - Intronic
958699885 3:97575070-97575092 CTCTTCAGTTTTTACTAGATAGG - Intronic
959328174 3:104964974-104964996 CTCTTGTGTATTTCTTTATTTGG + Intergenic
959717476 3:109448871-109448893 ATCTTCTTTTTTTCTTAGTTTGG - Intergenic
959790383 3:110354112-110354134 CTCTTCAGTTTTTCTATGCTAGG + Intergenic
960509180 3:118527456-118527478 ATCTTCAGTATTTCTCACATAGG + Intergenic
961230737 3:125305362-125305384 TTCTTCAGTTTTTGTTAGTCTGG - Intronic
961325691 3:126107950-126107972 CTCTTGATTATTCCTAAGTTAGG - Intronic
962068725 3:132011036-132011058 CTCCTCTGTTTTTCTTAGCTGGG + Intronic
963215619 3:142743594-142743616 CTCTTAAATATTTATTAATTTGG + Intronic
963703154 3:148652007-148652029 CTCTTCAATATTTTCTATTTTGG + Intergenic
965777266 3:172244452-172244474 CTCCTCAGATTTTCTTATTTTGG + Intronic
966451786 3:180071594-180071616 TTCTTCATTGTATCTTAGTTGGG - Intergenic
971928588 4:33048272-33048294 CTCTTCTGTATTTGTCAGTTGGG - Intergenic
972187757 4:36552028-36552050 CTCTTTCCTTTTTCTTAGTTGGG + Intergenic
972708775 4:41572768-41572790 CTAGTCAGTAATTCTTAGGTGGG + Intronic
973997021 4:56468304-56468326 CTCTTCAGTGTTATTAAGTTAGG + Intronic
973998652 4:56486760-56486782 GTTTTCAGAATTTCTTAGCTTGG + Intronic
975341454 4:73245865-73245887 CTTTTCTGTTTTTCTTAGATCGG - Intronic
975499655 4:75070678-75070700 ATCTTCAGAATTCCTTAGTGGGG + Intergenic
976912647 4:90326491-90326513 ATCTTCTGTTGTTCTTAGTTTGG + Intronic
977171896 4:93772512-93772534 CTCTTCACTGTTTCTTTTTTAGG + Exonic
977523710 4:98119424-98119446 CTCTTTAGAATCTCTTAATTTGG - Intronic
978177115 4:105745693-105745715 TTCTCCAGTAGTTCTTAGGTAGG + Intronic
979381279 4:120009624-120009646 TTCTTCAGCATTTCTTTGGTAGG - Intergenic
979416544 4:120447512-120447534 CTCTGCAGTATGTGTTATTTGGG + Intergenic
979431452 4:120637706-120637728 CTCTTGATGATTTCTTATTTGGG - Intergenic
979528063 4:121738185-121738207 CTCTTGATTATGTTTTAGTTAGG + Intergenic
980695918 4:136355406-136355428 CTCTTCTTTATTTCTTATTAAGG + Intergenic
980852291 4:138397241-138397263 CTTTTCAGTATGTCATAGTTTGG - Intergenic
981900362 4:149854754-149854776 CTATTTCTTATTTCTTAGTTTGG + Intergenic
982183990 4:152778152-152778174 CTCTGAAGTGTTTCTTATTTTGG - Intronic
982671857 4:158330160-158330182 CACTTGAGTAGTTTTTAGTTTGG - Intronic
982742844 4:159075816-159075838 CTCTTCAGTATTTTGTAATGAGG + Intergenic
982889482 4:160829457-160829479 CTCTTCTGTAGTTCTGAGATGGG - Intergenic
983373481 4:166895550-166895572 CACTTCAGTATTTTTATGTTTGG - Intronic
984085210 4:175301726-175301748 ATCTTCAGCATTTATTACTTAGG + Intergenic
985030846 4:185787778-185787800 CTCTACAGCATTTCTTAAATAGG + Intronic
985138547 4:186814007-186814029 CTTTTCAGTATTCCTAACTTTGG - Intergenic
986484789 5:8224933-8224955 CTCTTCACTATTTGTTAAATAGG - Intergenic
987056201 5:14195198-14195220 CTCTTTAGTCTTTTTTAGTCTGG + Intronic
987840230 5:23213910-23213932 CAATTCAGTATTTCTTATTTTGG - Intergenic
988298235 5:29392284-29392306 CTCTTCAGTACTTGTGGGTTAGG - Intergenic
989718180 5:44491336-44491358 GTCTCCAGAATTTCTTATTTTGG + Intergenic
992221965 5:74582009-74582031 CTCTCCAGGAGTTCTAAGTTGGG - Intergenic
992475501 5:77097993-77098015 CTCTACATGCTTTCTTAGTTTGG + Intergenic
992858479 5:80888624-80888646 GTCTTCAGTATTTTTTAGAAAGG + Intergenic
995235661 5:109826809-109826831 CTTTCCAGTATTTCTTAATAAGG - Intronic
996588046 5:125112986-125113008 CTCTGCAGTAATTTTAAGTTGGG - Intergenic
996850368 5:127944438-127944460 CACTTCAGAATTTCTCAGGTTGG - Intergenic
996905682 5:128596991-128597013 CACTTCAGATTTTCTTACTTGGG - Intronic
997175825 5:131776359-131776381 CTCTTCAGCATTTCTGTGTTTGG - Intronic
998910407 5:146953963-146953985 GTCTCCAGTATTTCTAAATTGGG + Intronic
999780210 5:154843097-154843119 CTCTTCAGTGTTTGTTAGGAAGG + Intronic
1000102298 5:158027741-158027763 CTCTAAACTATTTCTTAGGTGGG + Intergenic
1000162918 5:158617630-158617652 CTCTTCAGTAATTTTCTGTTAGG + Intergenic
1001187071 5:169584184-169584206 ATCTGCACCATTTCTTAGTTCGG - Intronic
1002588691 5:180271611-180271633 GTCTTCTGTATTTCTTCTTTAGG + Intronic
1003743930 6:8978129-8978151 CTCTTCTCTATTTCTTTGTGAGG + Intergenic
1004100413 6:12603828-12603850 CTCTCCATTATTACTGAGTTGGG + Intergenic
1004107344 6:12677979-12678001 ATTTTCAGTATTTCTTAATCAGG - Intergenic
1004135266 6:12960048-12960070 AGCTTCAGTTTTTTTTAGTTCGG + Intronic
1005123269 6:22415154-22415176 CTCTTCCATATTTTTTAATTTGG - Intergenic
1008274596 6:49528092-49528114 CTTGTCATTATTTCTTAATTTGG + Intergenic
1008641730 6:53470184-53470206 ATCTTCAGTATTATTTATTTGGG + Intergenic
1008938821 6:57022510-57022532 CTCTTTGTTATTTCTTAGTCTGG + Intronic
1009415912 6:63416338-63416360 ATATTCATTATTTCTCAGTTTGG - Intergenic
1009774455 6:68187505-68187527 CTCTCAAGTATTTCTCAGTTTGG - Intergenic
1010296626 6:74206172-74206194 CTCTACTGAATTTTTTAGTTTGG + Intergenic
1010753290 6:79638598-79638620 CTCATCAGCATTTGTTACTTGGG + Intronic
1011425548 6:87225182-87225204 CTCTTGCCTATTTCTTAATTGGG + Intronic
1012586450 6:100928748-100928770 TTATTCAGGATTACTTAGTTGGG - Intergenic
1013476684 6:110514232-110514254 CTCTCCTGTATTTCTCAGTAGGG + Intergenic
1014134363 6:117871109-117871131 CTCTTAAGTATGTCCTGGTTTGG + Intergenic
1016922938 6:149314188-149314210 CTCTTCATTATCTCTCATTTGGG + Intronic
1016972955 6:149781655-149781677 CTCTTGACCATTTCTTAATTGGG + Intronic
1022718721 7:32923059-32923081 ATATTCAGTATTTCTGGGTTGGG + Intergenic
1022954190 7:35366473-35366495 CTCTTCAGAAATCCTTAATTGGG - Intergenic
1024612886 7:51082309-51082331 CGCTTCAGTATGTCTCAGCTGGG - Intronic
1024702030 7:51914041-51914063 CTCCTCAGTTTTTCTTATTTTGG - Intergenic
1026666624 7:72345942-72345964 CTCTTTATTTTTTCTTAATTCGG - Intronic
1027439935 7:78208878-78208900 CTCTTTAGTGTTCCTTATTTTGG + Intronic
1027801331 7:82754016-82754038 ATTTTCAGTATTTATTAGTAAGG + Exonic
1031438013 7:121756764-121756786 CTCTCCTGGATTTCTTATTTGGG - Intergenic
1035403821 7:158586313-158586335 CTCTGCAGTTTTTGTTTGTTTGG + Intronic
1039991567 8:42492407-42492429 CTCTGCAGTATTACTTCCTTAGG - Intronic
1043560421 8:81487287-81487309 CTCTTCATTAATGCTTAGTGAGG - Intergenic
1044227060 8:89731184-89731206 CTCTGCTGAATTTTTTAGTTAGG - Intergenic
1044579522 8:93810804-93810826 CTTTTAAGTGTTTCATAGTTTGG - Intronic
1045536642 8:103035442-103035464 CTCTTCAGGATTTCTCAGTAAGG + Intronic
1045937742 8:107701550-107701572 CTCTTCAGTTTTTAGAAGTTGGG + Intergenic
1046366915 8:113245719-113245741 CTGTTCTCTATTTCTTTGTTTGG + Intronic
1046425213 8:114038557-114038579 CTCTTGAGCATTTTTTTGTTTGG - Intergenic
1046661655 8:116954048-116954070 CTCCTAATTATTTCTAAGTTAGG - Intronic
1047119504 8:121885251-121885273 CTCTTAATTTTTTCTTACTTAGG + Intergenic
1048067104 8:130981445-130981467 CTCTTCAGCATTTTATAGTTAGG + Intronic
1050144684 9:2554604-2554626 CTCTTCATTTTTTTCTAGTTCGG - Intergenic
1050705589 9:8393069-8393091 TTCTTCAGTAGTTCTTGATTAGG + Intronic
1050851469 9:10292181-10292203 CTCCTCAGTATCTTTTACTTGGG - Intronic
1051166623 9:14268859-14268881 CTCTTTAGTACTTCTAATTTTGG - Intronic
1051730199 9:20133802-20133824 CTCTTCACTATATCTTAGGCAGG - Intergenic
1051761144 9:20466060-20466082 CTGTTCAGTTTTTCATTGTTTGG - Intronic
1052287278 9:26800369-26800391 CTTTTAAGTAATTCTTTGTTGGG - Intergenic
1054983482 9:71234394-71234416 GTCATCAGAATTTCATAGTTGGG - Intronic
1054993947 9:71363151-71363173 CTCTTCAGTAGTAATTTGTTGGG - Intronic
1055536816 9:77255589-77255611 CTCTTCAGTTTTTGATTGTTTGG + Intronic
1056471914 9:86913550-86913572 CTTGTCTTTATTTCTTAGTTTGG - Intergenic
1057532839 9:95869051-95869073 TTCTTCTTTATTTCTTAGTGTGG + Intergenic
1058150140 9:101454611-101454633 CTCTTCATTCCTTCTCAGTTTGG + Intergenic
1059258493 9:112953372-112953394 CTTTTTAATATTTGTTAGTTGGG + Intergenic
1188205756 X:27355744-27355766 CTCTTCAATGTTGCTTATTTGGG - Intergenic
1188615209 X:32149919-32149941 CACTTCTGAATTTCTCAGTTGGG + Intronic
1190531112 X:51377442-51377464 CTCTTGGTTGTTTCTTAGTTTGG + Intergenic
1191240504 X:58186496-58186518 ATCATTAGAATTTCTTAGTTAGG - Intergenic
1195314685 X:103666074-103666096 GTCTTCTGTATTTCTGGGTTTGG - Intergenic
1196558206 X:117116604-117116626 CTCTACAGTATTTCACTGTTTGG + Intergenic
1197179964 X:123523651-123523673 CTCATCAATATTTGTTATTTTGG + Intergenic
1197545071 X:127814516-127814538 CTCTTCTTTTTTTCTTAGTCTGG - Intergenic
1197578087 X:128246772-128246794 CTTTTCAGTATTTCCTGGTGAGG - Intergenic
1198227442 X:134658605-134658627 CTCTGCAGCATTTCCCAGTTTGG + Intronic
1199523079 X:148759420-148759442 CTCTTCATTCTTTCTTGTTTGGG - Intronic
1200341216 X:155398214-155398236 CTCTTCAGTATTATTTCCTTTGG - Intergenic
1200382025 X:155847855-155847877 GTCTTGAGTGTTTCTTTGTTGGG - Intergenic
1201510654 Y:14757828-14757850 CTCCTCAGTCTTGCATAGTTGGG + Intronic