ID: 908987736

View in Genome Browser
Species Human (GRCh38)
Location 1:70045243-70045265
Sequence GAAAGTTACCAGCACTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908987736_908987738 -2 Left 908987736 1:70045243-70045265 CCAGTGGAGTGCTGGTAACTTTC No data
Right 908987738 1:70045264-70045286 TCTCTCCAAGGAGAAAGACAAGG No data
908987736_908987740 11 Left 908987736 1:70045243-70045265 CCAGTGGAGTGCTGGTAACTTTC No data
Right 908987740 1:70045277-70045299 AAAGACAAGGCCTTGATTTGTGG 0: 1
1: 0
2: 4
3: 31
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908987736 Original CRISPR GAAAGTTACCAGCACTCCAC TGG (reversed) Intronic
No off target data available for this crispr