ID: 908989936

View in Genome Browser
Species Human (GRCh38)
Location 1:70074377-70074399
Sequence GGGTGTTTAATCTTCTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908989931_908989936 29 Left 908989931 1:70074325-70074347 CCATGGCAGCAAGCAAGAGTTGA 0: 1
1: 0
2: 0
3: 12
4: 179
Right 908989936 1:70074377-70074399 GGGTGTTTAATCTTCTAGAATGG 0: 1
1: 0
2: 1
3: 6
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908989936 Original CRISPR GGGTGTTTAATCTTCTAGAA TGG Intronic
903910627 1:26722171-26722193 ATGTGTCTGATCTTCTAGAATGG + Intronic
908961622 1:69704480-69704502 AAGTTTTTAATGTTCTAGAATGG + Intronic
908989936 1:70074377-70074399 GGGTGTTTAATCTTCTAGAATGG + Intronic
912197037 1:107410141-107410163 GGGTGTTACATCTGCTATAATGG - Intronic
916035202 1:160915873-160915895 AGGTCTTCACTCTTCTAGAAGGG - Intergenic
921421163 1:214950314-214950336 CTGTTTTTAATCTTCTTGAAAGG - Intergenic
1064158469 10:12923161-12923183 GGAAGTTTAATCTTCTAGAAGGG + Intronic
1066497143 10:35953439-35953461 AGGTGATGGATCTTCTAGAAGGG + Intergenic
1068549529 10:58390456-58390478 GGTTGTTTTATCTTTTAAAAAGG + Intronic
1068571565 10:58635390-58635412 GATTGTTTAATTTTGTAGAATGG - Intronic
1069207988 10:65717045-65717067 GGATGTTTAATATTCTATCAGGG + Intergenic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1071444589 10:85734145-85734167 GGGTGCTTTATCTCCTAGAGGGG + Intronic
1071880804 10:89896319-89896341 GGATGTCTAAACTTCTAGCAAGG + Intergenic
1075019764 10:118943408-118943430 GGGTGGTAAATCTTCTAGCTGGG - Intergenic
1078563428 11:12392908-12392930 AGGTGTTTCATCTTGCAGAATGG + Intronic
1080286851 11:30624935-30624957 GGGTTTTTAACCTTATGGAAAGG - Intergenic
1085036752 11:73305604-73305626 GGGTGTTTAAGGATCTAGACTGG - Intergenic
1086203422 11:84231019-84231041 GTGTGTTTAATTTTTTAGCAGGG - Intronic
1088766941 11:112990938-112990960 GGCTGTTTAAGCTTCCATAAAGG + Intronic
1090323622 11:125866058-125866080 TGGTGTTAAATCTTGTCGAATGG - Intergenic
1091339032 11:134795892-134795914 GGGAGTATTATCTTCTAGAGGGG + Intergenic
1093356235 12:18171837-18171859 AGGCCTTCAATCTTCTAGAATGG + Intronic
1093719358 12:22420715-22420737 GTGTCTTTAATTTTCTATAATGG + Intronic
1093719857 12:22427355-22427377 GTGTCTTTAATTTTCTATAATGG + Intronic
1098371576 12:69766188-69766210 GGGTGTTTACCTTTCTAGCAAGG + Intronic
1101721411 12:107353604-107353626 GGGTGTTTACTCTAGTAGAGTGG + Intronic
1101946568 12:109141766-109141788 GAGTGTTTGAGTTTCTAGAAGGG + Intronic
1107111465 13:36702497-36702519 GGGTCTTCACTCTCCTAGAAGGG - Intergenic
1108886982 13:55199010-55199032 GGGTGTTTAATCTTTTCCAAAGG - Intergenic
1110587559 13:77212156-77212178 GTTTATTTAATCTTTTAGAAAGG - Exonic
1110703100 13:78572379-78572401 TGTGGTTTAATCTTCTAGCAGGG - Intergenic
1112377651 13:98858613-98858635 GGGATTTAAATCTTCAAGAAAGG + Intronic
1112829515 13:103431301-103431323 TGGAGTTTTATCTTCTATAATGG + Intergenic
1114320064 14:21539807-21539829 GGGTGTGTAATATTCTGGATTGG + Intergenic
1114374253 14:22126710-22126732 TGGTCCTTAATCTTATAGAAAGG + Intergenic
1116252723 14:42507626-42507648 GGGTGTTGAATTTTATTGAAAGG - Intergenic
1116483919 14:45424037-45424059 AGGCCTTTACTCTTCTAGAAGGG + Intergenic
1117399963 14:55349971-55349993 GGGTGTTTAAAAATCTAGTAGGG + Intronic
1118344893 14:64931205-64931227 GACTGTTAAATATTCTAGAAAGG + Intronic
1121778497 14:96606714-96606736 GGGTGTTTATTCTAGAAGAATGG + Intergenic
1123854557 15:24394629-24394651 GAGAGTTTCATCTTCTACAAGGG - Intergenic
1130862902 15:87907243-87907265 GATTGATTAATCTTCTATAATGG + Intronic
1132278366 15:100590467-100590489 AGGCCTTCAATCTTCTAGAAGGG + Intronic
1139040970 16:62998503-62998525 AGGTGTTTAATTTTCTCTAAAGG + Intergenic
1139532716 16:67550752-67550774 GTGTGATTAGTCTTATAGAAGGG - Intergenic
1140360230 16:74337812-74337834 GGGTTTTTAATTTGCTAGAGAGG - Intergenic
1143394869 17:6585510-6585532 AGATGTTGAATCTCCTAGAACGG + Intronic
1154349131 18:13568427-13568449 GGTTGTTTCATGGTCTAGAATGG + Intronic
1157677962 18:49581356-49581378 GAGTGTCTAATCATCAAGAAGGG + Intronic
1159459879 18:68711681-68711703 AGGTGTAAAATGTTCTAGAAGGG - Intronic
1165508234 19:36248720-36248742 GTGTGATTAATCTTCTAGGATGG + Intergenic
1166267328 19:41692653-41692675 AAGTGTTTAATCTCCTATAAAGG - Intronic
928779056 2:34798852-34798874 GGATTGTTTATCTTCTAGAAGGG - Intergenic
929191200 2:39141776-39141798 GTGTGTTTAATTTTGGAGAAAGG - Intergenic
931834346 2:66083043-66083065 AGTTTTTTAATTTTCTAGAAAGG + Intergenic
933364945 2:81340742-81340764 GGGTGTTTGATTTTCTCAAATGG - Intergenic
937002643 2:118482225-118482247 GGGTGTTAAATGTGCTTGAAGGG - Intergenic
937038333 2:118801181-118801203 TGGTGTTACATGTTCTAGAATGG - Intergenic
939033620 2:137105337-137105359 GGGTGTTGAATTTTATTGAAGGG - Intronic
943216112 2:185038016-185038038 GGGTATTTAATTTTTTAAAAGGG - Intergenic
944292404 2:198022164-198022186 GGGTGTTGAATTTTATTGAAGGG - Intronic
944454193 2:199876520-199876542 GCCTGTTAAATCTTTTAGAAAGG - Intergenic
1177452937 21:21295421-21295443 TGGTGTATAATCTTCTTCAAGGG - Intronic
1178309454 21:31517621-31517643 GGGTGTTTCATATTCTACCATGG - Intronic
1179381902 21:40907631-40907653 GTTTGTTTAATCATCTAAAATGG + Intergenic
1182290388 22:29273621-29273643 GTTTTTTTAATCTTCTAGAAAGG + Intronic
1183172132 22:36196375-36196397 GCATTTTCAATCTTCTAGAAGGG + Intronic
1184618699 22:45656622-45656644 AGGTCTTCACTCTTCTAGAAGGG + Intergenic
952010203 3:28892050-28892072 GGGTGTTTTAAGTTCTAAAAAGG - Intergenic
955168255 3:56536883-56536905 TGGTGTTTATACTTATAGAAAGG + Intergenic
955271219 3:57501450-57501472 AAGTGTTTTATCTTCTAAAAAGG - Intronic
955745017 3:62131921-62131943 AGAATTTTAATCTTCTAGAATGG + Intronic
956997103 3:74839549-74839571 TTCTGTTTAATCTTTTAGAAGGG + Intergenic
957430530 3:80099561-80099583 GGATTTTTAAGTTTCTAGAATGG + Intergenic
965084257 3:164073998-164074020 AGGTCTTTACTCTTCTAAAAGGG - Intergenic
965278683 3:166720692-166720714 AGGTCTTCACTCTTCTAGAAGGG - Intergenic
971823069 4:31584971-31584993 TGGTGTCTCATCTTCTTGAAAGG + Intergenic
973555032 4:52074125-52074147 GGGTCCTTTTTCTTCTAGAATGG + Intronic
973999592 4:56498204-56498226 GGGTGTTGAATTTTATTGAAGGG - Intronic
976455331 4:85240122-85240144 GGGTGTTGAATTTTATTGAAGGG - Intergenic
979170125 4:117591216-117591238 AGGTCTTCACTCTTCTAGAAGGG - Intergenic
980639513 4:135557816-135557838 GTGCTTTTAATCTTCTAAAATGG + Intergenic
985246908 4:187988228-187988250 GGGTGGTAAATTTTATAGAAAGG + Intergenic
986962986 5:13238169-13238191 GGATGTGTAATCTTGTATAAAGG + Intergenic
987525402 5:19043927-19043949 GGTTATTTATTCTTCTAGATTGG + Intergenic
989282054 5:39655454-39655476 GAGAGTTTAATATTCTAGAAGGG - Intergenic
990082001 5:51928477-51928499 GGGCCTTCGATCTTCTAGAAGGG + Intergenic
994060089 5:95465766-95465788 GGATGCTTAATCTTTTATAATGG + Intronic
994642304 5:102425049-102425071 GGGTGTTAAATTTTATCGAAGGG - Intronic
995850767 5:116543614-116543636 GACTGTTTAATCTTCTCCAAAGG + Intronic
996427551 5:123331569-123331591 GGGTGTTGAATTTTGTTGAAAGG + Intergenic
996883107 5:128323469-128323491 GGGTGTTGAATTTTATTGAAGGG + Intronic
1001357253 5:171040574-171040596 GGGATTTTAATCCTGTAGAAGGG + Intronic
1001803764 5:174566067-174566089 GGCTGTTTAATAGACTAGAAAGG - Intergenic
1004765931 6:18726771-18726793 AGGTCTTCATTCTTCTAGAAGGG + Intergenic
1004967537 6:20871713-20871735 ACATGGTTAATCTTCTAGAAGGG - Intronic
1005669482 6:28090961-28090983 GGTGGATTAATCTTCTAGAAGGG - Intergenic
1011666840 6:89642425-89642447 GGGAGTTTAATCTTCCAGTAGGG - Intergenic
1014162945 6:118191091-118191113 AGGCCTTTACTCTTCTAGAAGGG - Intronic
1014344511 6:120251149-120251171 GGGTGTTGAATTTTATCGAAAGG - Intergenic
1014787800 6:125638215-125638237 GGGTGTTTAATCCTGTATTATGG + Intergenic
1016423118 6:143905766-143905788 GGGTGTTGAATTTTCTCAAATGG + Intronic
1017348105 6:153407933-153407955 GGATCTTCACTCTTCTAGAATGG - Intergenic
1017358096 6:153534051-153534073 GGGTGATTAATCTGCTCGATGGG + Intergenic
1020106530 7:5424655-5424677 GAGTCTCTAATCTTCTAAAAGGG + Intronic
1021057472 7:16067749-16067771 GGGTTTTTATTCATCCAGAAAGG + Intergenic
1021891460 7:25189780-25189802 AGGTCTTCACTCTTCTAGAAGGG - Intergenic
1021968016 7:25941158-25941180 TGGTGTTTAATCTGTTAGGAGGG - Intergenic
1022086621 7:27074764-27074786 GGGTAATTAATCATCAAGAATGG - Intergenic
1025065097 7:55847805-55847827 GGATTTCTAATTTTCTAGAATGG - Intronic
1030200602 7:106899574-106899596 GGGTGTTGAATTTTATCGAAAGG + Intronic
1033782588 7:144690356-144690378 GGGTGTTTAATCCAAAAGAATGG - Intronic
1033850008 7:145483441-145483463 AGGCCTTTACTCTTCTAGAAGGG - Intergenic
1041032300 8:53749649-53749671 GCATTTTTAATCTTCTATAATGG + Intronic
1041862781 8:62533326-62533348 GGGGGGATAATCTTATAGAATGG + Intronic
1042435043 8:68754444-68754466 GGGTTTTTAAGAATCTAGAAAGG + Intronic
1050947379 9:11543100-11543122 AGATGTTTAATCCTATAGAAAGG + Intergenic
1051218989 9:14828737-14828759 GTTTGTTTAATCTGCTATAACGG - Intronic
1052994640 9:34545344-34545366 GGGTGTGTTTTCTTCTAGATCGG + Intergenic
1055146741 9:72944646-72944668 GCTTGTTTAATGTTCTATAATGG + Intronic
1058098608 9:100892155-100892177 AGGTCTTTACTCTTCTGGAAGGG + Intergenic
1058986856 9:110216363-110216385 GTGTGTTTGGTCTTTTAGAAAGG + Intergenic
1193276793 X:79598294-79598316 GGGCATTTAATGTACTAGAAAGG + Intergenic
1194574566 X:95596370-95596392 AGGTGTTTTATCTTTTAGGAAGG - Intergenic
1195076129 X:101328458-101328480 GGATGTCTAAGTTTCTAGAAAGG - Intergenic
1195288424 X:103408226-103408248 TGGTGTTGAATCTGCTAGACAGG + Intergenic
1196365833 X:114922625-114922647 AGGTGTCTAAGCTTCTATAATGG - Intergenic
1198238290 X:134757864-134757886 AAGTGTTTAATCTTCATGAAGGG + Intronic
1199105797 X:143866083-143866105 AGGTCTTCACTCTTCTAGAAGGG + Intergenic
1199233472 X:145466146-145466168 AAGTGTTTGCTCTTCTAGAAGGG - Intergenic
1200658681 Y:5935915-5935937 AGGTCTTCATTCTTCTAGAAGGG - Intergenic
1202112705 Y:21440382-21440404 GGGTGTTGAATTTTGTGGAAGGG + Intergenic