ID: 908997920

View in Genome Browser
Species Human (GRCh38)
Location 1:70180358-70180380
Sequence CGCTTGAGCCTAGGGAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4657
Summary {0: 1, 1: 0, 2: 24, 3: 449, 4: 4183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908997920_908997923 0 Left 908997920 1:70180358-70180380 CCAGAACTCCCTAGGCTCAAGCG 0: 1
1: 0
2: 24
3: 449
4: 4183
Right 908997923 1:70180381-70180403 ATCCTCCTGCCTCAGCCACCTGG 0: 3
1: 332
2: 3708
3: 4035
4: 3664
908997920_908997929 9 Left 908997920 1:70180358-70180380 CCAGAACTCCCTAGGCTCAAGCG 0: 1
1: 0
2: 24
3: 449
4: 4183
Right 908997929 1:70180390-70180412 CCTCAGCCACCTGGGTAACTGGG 0: 3
1: 144
2: 6445
3: 114973
4: 220744
908997920_908997924 1 Left 908997920 1:70180358-70180380 CCAGAACTCCCTAGGCTCAAGCG 0: 1
1: 0
2: 24
3: 449
4: 4183
Right 908997924 1:70180382-70180404 TCCTCCTGCCTCAGCCACCTGGG No data
908997920_908997927 8 Left 908997920 1:70180358-70180380 CCAGAACTCCCTAGGCTCAAGCG 0: 1
1: 0
2: 24
3: 449
4: 4183
Right 908997927 1:70180389-70180411 GCCTCAGCCACCTGGGTAACTGG 0: 2
1: 106
2: 5113
3: 100700
4: 208331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908997920 Original CRISPR CGCTTGAGCCTAGGGAGTTC TGG (reversed) Intronic
Too many off-targets to display for this crispr