ID: 909004256

View in Genome Browser
Species Human (GRCh38)
Location 1:70256490-70256512
Sequence GATGCTTGTCTTCCAAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909004256_909004258 29 Left 909004256 1:70256490-70256512 CCAAATTTTGGAAGACAAGCATC No data
Right 909004258 1:70256542-70256564 ACAAAATTAATATATCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909004256 Original CRISPR GATGCTTGTCTTCCAAAATT TGG (reversed) Intergenic
No off target data available for this crispr