ID: 909004663

View in Genome Browser
Species Human (GRCh38)
Location 1:70261108-70261130
Sequence ATGGACCTATTGAATTTTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909004663_909004667 -6 Left 909004663 1:70261108-70261130 CCCCCAAAATTCAATAGGTCCAT 0: 1
1: 0
2: 2
3: 21
4: 202
Right 909004667 1:70261125-70261147 GTCCATGTAACGTAGTAATTAGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909004663 Original CRISPR ATGGACCTATTGAATTTTGG GGG (reversed) Exonic
900857547 1:5198091-5198113 ATGAATCTCTTGAATTTGGGAGG + Intergenic
901484787 1:9551369-9551391 ATTTACCTATTGATTTTTGGGGG - Intronic
905351467 1:37349486-37349508 ATTGATGTATTGAATTATGGGGG - Intergenic
908146317 1:61248428-61248450 GTGGACCAATTCAAGTTTGGGGG - Intronic
908745412 1:67371651-67371673 ATGGAAATAAGGAATTTTGGTGG + Intronic
909004663 1:70261108-70261130 ATGGACCTATTGAATTTTGGGGG - Exonic
910197810 1:84662506-84662528 ATGGACATTTTGAATTATGTCGG - Exonic
910750848 1:90628344-90628366 ATGAAAATATTGAATTTTTGTGG + Intergenic
911866468 1:103030852-103030874 ATGCACATATTCCATTTTGGAGG - Intronic
912030327 1:105233520-105233542 GTGACCCCATTGAATTTTGGAGG - Intergenic
912852074 1:113135436-113135458 TTTGATGTATTGAATTTTGGAGG - Intergenic
913514975 1:119596907-119596929 ATTGTCCTATTTGATTTTGGTGG + Intergenic
914462872 1:147900961-147900983 ATGGACATATTGCATTTTGATGG - Intergenic
916579484 1:166094848-166094870 ATACACCTATTGAATGCTGGAGG + Intronic
918050359 1:180968055-180968077 ATGAATCTGTAGAATTTTGGCGG + Intergenic
918755721 1:188337839-188337861 AAGGGCCTCTAGAATTTTGGAGG - Intergenic
919234821 1:194827439-194827461 ATGGACTTATATAATTATGGAGG + Intergenic
922896797 1:229107090-229107112 ATGGATCTATTGGCTTTGGGAGG - Intergenic
923615360 1:235532924-235532946 AAGGCCCCATTGAATTTTAGGGG - Intergenic
1063798264 10:9538548-9538570 ATGGACCTCTTTAAGTTTGTTGG + Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065255538 10:23863335-23863357 ATGGAAACACTGAATTTTGGAGG - Intronic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066537367 10:36406557-36406579 ATGGACCTAGTGAATATGGCAGG + Intergenic
1067328752 10:45294557-45294579 ATGGACCTGTTTAAGTTTGGAGG + Intergenic
1068080089 10:52309096-52309118 ATAGAACTATTAACTTTTGGCGG - Intergenic
1069065287 10:63936216-63936238 ATGGATCTACTGCATTTTGTAGG - Intergenic
1069188724 10:65461261-65461283 CTGGACTTATTGATTTTTGAGGG + Intergenic
1071095505 10:81969367-81969389 GGGGACCTATTGATTTTAGGGGG - Intronic
1071267129 10:83974292-83974314 GTGGGCCTATTGGATTTTGGAGG - Intergenic
1072211498 10:93250560-93250582 ATGGAACCATGGAATTTTTGTGG + Intergenic
1074342324 10:112645236-112645258 ATGATCTTATTGAATTCTGGGGG - Intronic
1074372373 10:112910477-112910499 ATGGACCTATTGAATAGAGGAGG - Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1077962785 11:7092069-7092091 ATGAAGCTATTGATTTTTTGTGG - Intergenic
1078048668 11:7942207-7942229 ATGGAAATACTAAATTTTGGGGG + Intergenic
1080252576 11:30251039-30251061 CTGGACCTAGAAAATTTTGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1086011937 11:82115232-82115254 GTGGACCTATTGACTTATGTGGG + Intergenic
1088588799 11:111383353-111383375 ATGGACCTATTTTATTTTACTGG + Intronic
1088866100 11:113849568-113849590 ATGGCCCTATGGAAATTTGAAGG + Intronic
1089137827 11:116263710-116263732 ATGGAACTATTGAGTGGTGGTGG - Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092571162 12:9723251-9723273 ATGAACCTATTTGATTTTGGGGG - Intronic
1093060775 12:14600957-14600979 ATAGAACAAATGAATTTTGGAGG - Intergenic
1093391935 12:18634350-18634372 GTGGGCCTATGGGATTTTGGAGG + Intronic
1096875385 12:54626097-54626119 ATGAACCTGGGGAATTTTGGGGG + Intergenic
1097614780 12:61870994-61871016 AAGTACTTATTGAATGTTGGTGG + Intronic
1099280315 12:80636465-80636487 ATGGGCCAAATGAATTTTAGTGG + Intronic
1099571082 12:84319697-84319719 TTGGTCCTATTGAAGATTGGAGG - Intergenic
1107360259 13:39609928-39609950 ATGGACATTTTCAATTTTGATGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108296333 13:49021745-49021767 ATGGAGCAATGGATTTTTGGAGG + Intronic
1108430398 13:50347583-50347605 ATGGACATGTTGAATTTGTGGGG + Intronic
1109503898 13:63273862-63273884 ATGGTCCTGTGGAAATTTGGGGG - Intergenic
1110688257 13:78400961-78400983 TTGGGCATATTTAATTTTGGGGG - Intergenic
1112069663 13:95835312-95835334 ATGAAGCCACTGAATTTTGGGGG + Intronic
1112151586 13:96770691-96770713 ATGCTTCTATTGAATTCTGGTGG - Intronic
1112877456 13:104061994-104062016 ATGAAACTGTGGAATTTTGGAGG - Intergenic
1113010237 13:105756449-105756471 ATGGACATATTAAACCTTGGTGG - Intergenic
1114663100 14:24361815-24361837 ATGGAGCCACTAAATTTTGGGGG + Intergenic
1115811376 14:37112242-37112264 AGGGGCCTGTTGTATTTTGGCGG - Intronic
1116020508 14:39454705-39454727 TTCAAACTATTGAATTTTGGTGG + Intergenic
1116738028 14:48719261-48719283 CTGGTCCTTTTAAATTTTGGGGG - Intergenic
1116751236 14:48888241-48888263 ATGGACCTATTTTATTATTGGGG - Intergenic
1117235964 14:53774951-53774973 ATTTACCCATTGTATTTTGGGGG + Intergenic
1117827854 14:59722240-59722262 ATGGACATACGGAATTTGGGAGG + Intronic
1119589735 14:75874865-75874887 ATGGAACTATAAGATTTTGGGGG + Intronic
1121380171 14:93458534-93458556 AAGAACCTATAAAATTTTGGGGG + Intronic
1126968233 15:54080629-54080651 ATGGATCTTTTGTATTTTTGTGG + Intronic
1135050638 16:19189984-19190006 ATGGAGCTATGGCATTTTTGGGG + Intronic
1137756119 16:50903726-50903748 ATGGATCTAGTAGATTTTGGTGG - Intergenic
1138013499 16:53407329-53407351 GTGGACATTTTGAGTTTTGGTGG + Intergenic
1138087734 16:54148998-54149020 ATGGAATTCTTGAACTTTGGAGG + Intergenic
1138404557 16:56779284-56779306 AGGGAGCTATTGAACTTTTGTGG - Intronic
1140874317 16:79136774-79136796 ATGTGCCTATTGAATTTTGTTGG - Intronic
1143069792 17:4281536-4281558 AAAGACCTATTGATTTGTGGGGG - Intronic
1147495582 17:40912110-40912132 AGGGCCCTATTGACCTTTGGTGG + Intergenic
1147651739 17:42066622-42066644 GTCAACATATTGAATTTTGGGGG - Intergenic
1154461644 18:14595631-14595653 ATGGACCTATGTAATGTTAGGGG - Intergenic
1155684048 18:28525331-28525353 GGGGACCTATTATATTTTGGAGG - Intergenic
1158854416 18:61528499-61528521 ATGGTCCTGTTGACATTTGGGGG + Intronic
1159768541 18:72520631-72520653 ATGGAGTTATTGAAATTAGGTGG + Intergenic
1162266588 19:9580560-9580582 GTAAACCTCTTGAATTTTGGAGG + Intronic
1162277810 19:9671525-9671547 ATAGACCTCTTGAATTTTGGAGG + Intronic
1163056342 19:14721945-14721967 ATGGAATTACTGGATTTTGGAGG + Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164448381 19:28337155-28337177 ATGGGCATATTGCATATTGGTGG - Intergenic
1166322891 19:42029856-42029878 GTGGACTTTTTGGATTTTGGTGG - Intronic
1168244467 19:55104611-55104633 AAGGATCTCTTGAATCTTGGAGG + Intronic
1168468795 19:56624801-56624823 ATGGACATATTGAATTTCTCAGG + Exonic
926428283 2:12759759-12759781 AGACACCTACTGAATTTTGGAGG + Intergenic
928815022 2:35283244-35283266 ATGGATCTATTGAATATTAAGGG + Intergenic
928963778 2:36956815-36956837 ATGGCCCTACTAATTTTTGGGGG - Intronic
929727995 2:44452374-44452396 ATGCAACCATTGCATTTTGGGGG + Intronic
930745110 2:54874853-54874875 ATGGACATCCTGAAGTTTGGTGG + Intronic
931356286 2:61539533-61539555 AAGGGCCTAGTAAATTTTGGTGG - Intergenic
931827430 2:66016247-66016269 AGGGACCTTTGGAATTTTGCAGG + Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
933067015 2:77810121-77810143 CTGGACCTAGTTCATTTTGGGGG + Intergenic
935436531 2:103041143-103041165 ATGAACGTCTTGAATTTTGGGGG - Intergenic
936225160 2:110642643-110642665 TTGGAGTTATTGGATTTTGGGGG + Intronic
940807355 2:158203010-158203032 ATGGACTTCTTTAATCTTGGAGG - Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941145712 2:161841871-161841893 ATTTAGCTATTAAATTTTGGGGG - Intronic
945828947 2:214759936-214759958 AGCGTCCTATTGAATATTGGTGG - Intronic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1168987274 20:2060553-2060575 CCTGACCTACTGAATTTTGGTGG - Intergenic
1169940353 20:10930509-10930531 CTGGACTTATTGATTTTTGAAGG - Intergenic
1170169228 20:13392918-13392940 ATGGCCCCATTTGATTTTGGTGG - Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172318174 20:33972920-33972942 ATGGAGCTATTCCATGTTGGTGG + Intergenic
1173441532 20:43081238-43081260 ATGGCCCTAATGATTTTGGGAGG + Intronic
1174517995 20:51108054-51108076 ATGAACCTATGGAATTCTCGGGG + Intergenic
1175756603 20:61534141-61534163 CTGGAAATATTGATTTTTGGAGG + Intronic
1177296782 21:19186317-19186339 ATGGACCAAATAAATTTTGGAGG - Intergenic
1182868712 22:33627463-33627485 ATGGAAGTATTGAATGCTGGAGG - Intronic
1184603604 22:45558691-45558713 GTGGGCCTATTGGATTTTGGAGG - Intronic
955222536 3:57035288-57035310 AAGGAAATATTGGATTTTGGTGG - Intronic
956818252 3:72928707-72928729 AAGGACCATTTGAATTTTTGAGG - Intronic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
958026256 3:88052671-88052693 TTGGCCCTATTGAATTTTCAGGG - Exonic
958506816 3:94989702-94989724 ATGTGCCTATTGAAAATTGGTGG - Intergenic
958830316 3:99079409-99079431 ATTGCCCTATGGAATTATGGAGG - Intergenic
960928454 3:122819915-122819937 ATTGACCTAATGAGTTTTGGAGG + Intronic
961198103 3:125020658-125020680 ATGGCACTATTGCATTTTGATGG - Intronic
963796028 3:149631798-149631820 GTGGACCTACTTAATTTTGTTGG - Intronic
965869733 3:173251320-173251342 ATGGGGCTATTGAATTTAGTTGG + Intergenic
966057454 3:175712904-175712926 ATGGAGCTACTGAGATTTGGGGG + Intronic
966591196 3:181684659-181684681 ATAGAAATATTGTATTTTGGGGG - Intergenic
966989387 3:185213498-185213520 ATTAACATATTGAATTTTTGTGG + Intronic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
973059709 4:45706725-45706747 ACGGATATATTGCATTTTGGTGG + Intergenic
973168545 4:47109631-47109653 TTGGACATTTTGAATTTTAGAGG + Intronic
974234545 4:59164104-59164126 AAGGACCTTTTGAATTTCTGTGG - Intergenic
974419899 4:61659977-61659999 ATGGACTGATTGGATATTGGGGG + Intronic
974425431 4:61736908-61736930 ATGGACTTATTGCAGTTTAGAGG + Intronic
974479076 4:62421155-62421177 GTGGGCCTTTTGAATTTTGGAGG - Intergenic
974915711 4:68175311-68175333 GTGGACATATTAAGTTTTGGGGG + Intergenic
975497486 4:75050925-75050947 AGAGTGCTATTGAATTTTGGGGG - Intergenic
976008391 4:80458189-80458211 ATGTGACTCTTGAATTTTGGGGG - Intronic
977040443 4:92010232-92010254 CTGGAACAATTGAATTTTGGGGG + Intergenic
978707070 4:111726331-111726353 ATGCACCTATTGTATTTGGGAGG - Intergenic
980313096 4:131161111-131161133 ATGTACATTTTGAATTATGGGGG - Intergenic
980838289 4:138224981-138225003 ATGAACATATAGCATTTTGGTGG + Intronic
983715513 4:170776820-170776842 AGGGACCTGTTGAATGGTGGAGG + Intergenic
986159111 5:5208336-5208358 AAGGGCCTATTGAAATTTGTAGG + Intronic
987462784 5:18233413-18233435 AAGGATGTCTTGAATTTTGGAGG - Intergenic
987854547 5:23402759-23402781 ATTGACCAATGGGATTTTGGTGG + Intergenic
987885402 5:23806181-23806203 GTGGGCCTATTGGATTTTGGAGG + Intergenic
988056609 5:26105580-26105602 GTGGACCTATTTGAATTTGGGGG - Intergenic
988217041 5:28288092-28288114 GTGGGCCTCTTGGATTTTGGAGG + Intergenic
989187061 5:38635957-38635979 ATGGCCCTATGGAAATTTGAGGG + Intergenic
989245969 5:39255129-39255151 ATGGAGCTATTTACATTTGGGGG + Intronic
990688732 5:58337983-58338005 CTGGACCTATTAAAATTTGTGGG + Intergenic
991778727 5:70111604-70111626 CTGCACCTAATGACTTTTGGAGG - Intergenic
991858018 5:70987071-70987093 CTGCACCTAATGACTTTTGGAGG - Intronic
991871176 5:71111957-71111979 CTGCACCTAATGACTTTTGGAGG - Intergenic
994166532 5:96614974-96614996 GTTGAACTATTGAAATTTGGGGG - Intronic
997621600 5:135302130-135302152 CTGGAACTGTTGTATTTTGGTGG + Intronic
998290375 5:140908868-140908890 TTGGGACTATTGGATTTTGGAGG - Intronic
1006110014 6:31738815-31738837 ATGGAGCTATAGAAACTTGGAGG - Intronic
1008494440 6:52118398-52118420 TTGGACAGGTTGAATTTTGGGGG - Intergenic
1008786324 6:55173292-55173314 ATGGAAGTAGTGAATTGTGGTGG + Intronic
1009032772 6:58080778-58080800 ATGGACATTTTGAGTTTTAGAGG + Intergenic
1009208385 6:60832550-60832572 ATGGACATTTTGAGTTTTAGAGG + Intergenic
1009847620 6:69153489-69153511 AGGGACTTATAGCATTTTGGAGG - Intronic
1010515931 6:76772545-76772567 ATGGAGCTGTTGAATGGTGGTGG + Intergenic
1011127913 6:84026768-84026790 ATGCACCAATTCAATTTTGAGGG + Intergenic
1012190032 6:96267698-96267720 TTGGACCTATATAATTTTGTAGG - Intergenic
1014292078 6:119570546-119570568 ATGGACCTATCAATTTTTGGTGG - Intergenic
1014337104 6:120150423-120150445 AATGACCTTTTGTATTTTGGTGG - Intergenic
1017125028 6:151057286-151057308 ATGGACATATGGAAAATTGGAGG + Intronic
1017386361 6:153889441-153889463 TTGGAGGTATTGAATATTGGTGG + Intergenic
1017931719 6:158961258-158961280 AGGCACCTTTTGAATTTAGGGGG + Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020610383 7:10389385-10389407 ATTCATCTATTGAATTTTGAAGG - Intergenic
1022787965 7:33657902-33657924 CTGGAGCTTTTGAAATTTGGGGG + Intergenic
1023278473 7:38545731-38545753 AAGAACCTGTGGAATTTTGGTGG - Intronic
1026261499 7:68759433-68759455 ATGGACAAATTCAGTTTTGGGGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1031060116 7:117041747-117041769 ATGGACATAGAGATTTTTGGGGG - Intronic
1034089448 7:148350432-148350454 ATGGATCTAATGATTTTTTGAGG + Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039292335 8:36110196-36110218 GTGGGCCTCTTGGATTTTGGAGG - Intergenic
1040660760 8:49572651-49572673 ATGGATTTATTGAAAATTGGTGG - Intergenic
1040748432 8:50674621-50674643 CTGGATTTATTGATTTTTGGAGG + Intronic
1044421462 8:92000616-92000638 ATGGACCTATTCAGTTTAGTTGG + Intronic
1045295805 8:100870876-100870898 ATGGTCCAATTGATTTTTGATGG - Intergenic
1045624793 8:104031578-104031600 AGGGATCTATGGGATTTTGGGGG - Intronic
1045908761 8:107380696-107380718 ATGGACCTATTGCTTTCTGAGGG + Intronic
1046715710 8:117564346-117564368 TTATACTTATTGAATTTTGGGGG - Intergenic
1046971214 8:120225424-120225446 ACAGACCTTTTGAATTTAGGTGG - Intronic
1048956127 8:139537640-139537662 ATAGGCCTCTTGAAATTTGGAGG - Intergenic
1050135597 9:2460125-2460147 ATAGACCTCTTAAAATTTGGAGG + Intergenic
1052216534 9:25972784-25972806 ATGGGCCATTTTAATTTTGGAGG + Intergenic
1052699796 9:31923701-31923723 ATGCACCTATTGAAGTTTAAGGG - Intergenic
1055282245 9:74688174-74688196 ATGGACCTTTTGAAGCTGGGAGG + Exonic
1056697805 9:88874748-88874770 ATGGCACTATTCACTTTTGGGGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1060429104 9:123533534-123533556 ACAGACCTCTTGGATTTTGGAGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1188243672 X:27817371-27817393 GAGGAGGTATTGAATTTTGGAGG - Intronic
1188595859 X:31899408-31899430 AGGTGCCTATTGATTTTTGGAGG + Intronic
1189510381 X:41655982-41656004 ATGGCCCTATGGAAATTTGAGGG + Intronic
1191891095 X:65942209-65942231 ATGGATATATTGAATAGTGGTGG + Intergenic
1197995850 X:132372148-132372170 AATGAGCTATTGCATTTTGGAGG + Intronic
1199519561 X:148720197-148720219 ATTTACTTATTTAATTTTGGTGG + Intronic
1200345563 X:155443198-155443220 ATTGAAATTTTGAATTTTGGGGG - Intergenic
1200746102 Y:6905192-6905214 GTGGACCTATTGGATTTTGGAGG - Intergenic