ID: 909004985

View in Genome Browser
Species Human (GRCh38)
Location 1:70265216-70265238
Sequence CAAGGTGACAAGAGTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909004981_909004985 28 Left 909004981 1:70265165-70265187 CCGGGGTAGTACTATAACTGGAG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG 0: 1
1: 0
2: 2
3: 29
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909004985 Original CRISPR CAAGGTGACAAGAGTGAAGA GGG Intronic
900821490 1:4892825-4892847 CAGGGTGAGAAGAGTGCAGAAGG - Intergenic
903360016 1:22771243-22771265 CAAGGTGACAAGTATAATGATGG + Intronic
905266165 1:36755666-36755688 CAAGGAGACAAAAGGGATGAGGG - Intergenic
906016299 1:42583856-42583878 CAAGGTGAAAACCATGAAGATGG + Intronic
906154171 1:43604407-43604429 CAAGGTCACAAGAGATCAGAAGG - Intronic
906165295 1:43681571-43681593 CAAGGTGACAGGCTTTAAGAGGG - Intronic
906603296 1:47147926-47147948 CCAAGTGACAAGACTGAGGAAGG + Intronic
906634951 1:47403180-47403202 CAAGGTGTCAAGTGTGTATAGGG - Intergenic
907009733 1:50952369-50952391 CGAGGTGTCAAGATTGCAGACGG + Intronic
907431433 1:54414380-54414402 CAACGTGACAAGGGTGGTGATGG + Intergenic
907580909 1:55571875-55571897 CAAGCTGACAAAAGTGAAAGGGG - Intergenic
908617486 1:65938293-65938315 TAAGGTGACACAAGTCAAGATGG - Intronic
908756050 1:67469861-67469883 CAAACTGAAAAGAGTGAAAAAGG + Intergenic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
908923795 1:69228762-69228784 CAAGCTGGCAAGAATGAAAAAGG + Intergenic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
909023098 1:70453402-70453424 GCAGGTGAAAAGAGGGAAGAAGG + Intergenic
909023181 1:70454510-70454532 GCAGGTGAGAAGAGAGAAGAAGG + Intergenic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
910047370 1:82933832-82933854 CAGGGTCACAGCAGTGAAGAAGG + Intergenic
910310902 1:85823561-85823583 CCAGGTGACCAGGGTGAACAAGG - Exonic
910566552 1:88650101-88650123 CATGATGATAATAGTGAAGATGG + Intergenic
910815831 1:91289596-91289618 CAAGGTGCCAGGATTGCAGACGG - Intronic
911858473 1:102913653-102913675 GGTGGTGACAAGGGTGAAGATGG - Exonic
912373598 1:109192581-109192603 CAAGGAAACAAGAGGGGAGAGGG - Intronic
912503407 1:110137461-110137483 CATGGGGAAAAGGGTGAAGAAGG - Intergenic
913219028 1:116644636-116644658 CAAGGTGACAGCAGAGAGGATGG + Intronic
913382149 1:118224170-118224192 CAAGGAGATAAGAATGAGGATGG + Intergenic
914835669 1:151204730-151204752 CAAGGTGACAAAAGGAAAAAGGG - Intronic
916466223 1:165076924-165076946 TAAGGTGATAACAGTGCAGATGG + Intergenic
916577990 1:166084017-166084039 CAAGGTAACAGGAGGGTAGATGG + Intronic
916988257 1:170214691-170214713 CAAGGAGACAAGAGAAAGGAAGG + Intergenic
919032432 1:192260275-192260297 GAAGGTGATAAGAGAGAAAAGGG + Intergenic
919593269 1:199530588-199530610 AAAGGGAACAAGAGTGAGGATGG - Intergenic
921683835 1:218067086-218067108 CAAGGTGACAACTTTGAAGGGGG + Intergenic
922574879 1:226654919-226654941 GAAGAGGAGAAGAGTGAAGAGGG + Intronic
924202147 1:241671723-241671745 CAAGGTGTTAAGAGTGGAGAGGG - Intronic
924712095 1:246537905-246537927 CATGGTGACAAAAGGGAAGATGG - Intergenic
1064099531 10:12451431-12451453 GAAGAGGGCAAGAGTGAAGATGG - Intronic
1064428428 10:15250953-15250975 AAAGGTGACAAGGGAGGAGAAGG - Intronic
1064566866 10:16648561-16648583 GAAGGGGACAACAGTGAAGAAGG + Intronic
1064583300 10:16815479-16815501 GGATGTGACAAGAGAGAAGAAGG - Intronic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1067541521 10:47158523-47158545 AAAGATGACAAGAGCGAACAAGG + Intergenic
1068798198 10:61107814-61107836 AAAGGAGACAAGAGGGAAAAGGG + Intergenic
1069310328 10:67027149-67027171 TAAGGTGAGAAGACAGAAGAGGG + Intronic
1069797199 10:71061061-71061083 CTTGGCGACAAGAGTGAAGCTGG + Intergenic
1070144409 10:73763413-73763435 CAGAGTGCCAAGAGTGAAAAAGG - Intronic
1070500155 10:77065192-77065214 CAAGGTGAGCACTGTGAAGATGG - Intronic
1071106532 10:82103847-82103869 CAAGGTGAGAAAAAAGAAGAGGG + Intronic
1071222869 10:83490269-83490291 CATGGGGAAAAGAGTGCAGAAGG - Intergenic
1073530061 10:104222582-104222604 CAAGGGGGCAGGAGTGAGGAGGG - Intronic
1073906353 10:108285172-108285194 CAAGAGAACAAGTGTGAAGAAGG - Intergenic
1075474183 10:122719136-122719158 CAAGGGGACAGAAGTGAAGCAGG + Intergenic
1075514531 10:123098454-123098476 TTAGGTGACAATAGAGAAGAGGG + Intergenic
1075518913 10:123132402-123132424 CAAGGAGCCAAGAGGGCAGAAGG - Intergenic
1075955424 10:126519162-126519184 AAAGGTGAACAGAGTGGAGAGGG + Intronic
1077727644 11:4691454-4691476 CATGGTGACCAGAGTGGATATGG + Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1079761518 11:24335332-24335354 CAATGTGACATGAGTGAATGTGG + Intergenic
1080914167 11:36638226-36638248 CAATGTGAAAATACTGAAGAAGG - Intronic
1080915969 11:36659914-36659936 CAAGGAGAAAAGAGGGATGAAGG + Intergenic
1081410991 11:42758401-42758423 AAAGGTGAGTAGAGAGAAGAAGG - Intergenic
1081525568 11:43925323-43925345 CCTGGTGACAAGAGGGAACATGG + Exonic
1081917050 11:46739044-46739066 CAAGGTTACAAGCCTGATGAAGG + Exonic
1083962226 11:66020860-66020882 CAAGGTGAAGAGGGTGAAGATGG + Exonic
1084117873 11:67052523-67052545 GAAGATTACAAGAGAGAAGAAGG - Intergenic
1084358228 11:68653180-68653202 CAAGGTGACAAGTGTTTTGATGG - Intergenic
1084721902 11:70911760-70911782 CAAAATGACAAGAGTGAGAATGG + Intronic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1087505001 11:99009548-99009570 AAAGGTGACAAGATGGATGATGG + Intergenic
1087696223 11:101379174-101379196 CAAGGAGACTTTAGTGAAGAAGG + Intergenic
1088318878 11:108534513-108534535 CAAGGTGCAGAGAGTGGAGAAGG - Intronic
1088325459 11:108596239-108596261 CAAGAAGAGTAGAGTGAAGATGG + Intergenic
1089411293 11:118245118-118245140 CAAGGAATCAAGAGTGAATATGG + Intronic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1089761170 11:120724842-120724864 CAAGTTGGCAAGAGTGAAGAGGG - Intronic
1090331927 11:125939297-125939319 GGAGGTGACAAGCCTGAAGATGG + Intergenic
1091507917 12:1091776-1091798 GAAGGAGAGAAGAGTGAACAAGG + Intronic
1092097628 12:5856691-5856713 CAAAGTGTCAAGAGAGAAGCTGG + Intronic
1093833336 12:23793878-23793900 CTAGGTGACAAAATTTAAGAAGG - Intronic
1094426575 12:30322605-30322627 CAAGGTGAAGAGGGTGTAGACGG + Intergenic
1095659759 12:44717862-44717884 CAAGGAGACCAGAGTGATGCAGG + Intronic
1095956504 12:47809346-47809368 ACAGGTGAGAAGAGTGAGGAAGG - Intronic
1096103367 12:48982436-48982458 AAAGGAGAGAAGAGTGGAGAGGG - Intergenic
1097287230 12:57887709-57887731 CAAGATGAAAAGAGTTAATATGG - Intergenic
1099845872 12:88027876-88027898 CAAGGGGGAGAGAGTGAAGATGG - Intronic
1100405651 12:94270888-94270910 AAAGGGGAGCAGAGTGAAGAGGG + Intronic
1101018919 12:100531749-100531771 TAAGATGCCTAGAGTGAAGAAGG - Intronic
1101659093 12:106750154-106750176 CAAGGCCACAAGAGTGGAAATGG + Intronic
1101822906 12:108197570-108197592 CAATGAGACAAGGGTGATGAAGG + Intronic
1102101713 12:110283247-110283269 GACGGTGACAAGAATGATGACGG + Intronic
1102201531 12:111060875-111060897 GAAGCTGACAAGAGGGTAGAAGG - Intronic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102464530 12:113120683-113120705 CAAGTAGGCAAGAGGGAAGATGG + Intronic
1103424741 12:120823318-120823340 CAAGGAGATACCAGTGAAGACGG - Intronic
1104048555 12:125181327-125181349 CAAGCTGCCAAGAAGGAAGAGGG + Intergenic
1104060615 12:125264784-125264806 CAAGGGGAAAAGAATGCAGATGG - Intronic
1104147551 12:126049758-126049780 CCAGGGGACAAGATTTAAGATGG + Intergenic
1104330099 12:127836668-127836690 CGTGGTGACAAAAGAGAAGATGG + Intergenic
1105432917 13:20353408-20353430 CAAGGTCACAAGTCTGAAGTAGG + Intergenic
1107600091 13:42004364-42004386 CATGGAGACAGGAGGGAAGAAGG - Intergenic
1108420546 13:50244768-50244790 GAATGTGACAAGAGGGAAGGTGG - Intronic
1108470097 13:50758906-50758928 CAAGGGGAGAAGATTGCAGAAGG + Intronic
1111111156 13:83711460-83711482 CAAGGGAAAAAGAGAGAAGAAGG + Intergenic
1111915048 13:94351939-94351961 CAAGGAGAGGAGAGAGAAGAAGG + Intronic
1113010985 13:105765282-105765304 CAAGGTGACAAGACACAATATGG - Intergenic
1113899136 13:113786585-113786607 GATGGTGACAACAGTGATGATGG - Intronic
1113899138 13:113786609-113786631 GATGGTGACAACAGTGACGACGG - Intronic
1116417861 14:44699784-44699806 GAAGTGGACATGAGTGAAGAGGG - Intergenic
1117659534 14:57989098-57989120 AGAGGTGGCAAGAGAGAAGAAGG - Intergenic
1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG + Intergenic
1118862081 14:69672281-69672303 GAAGGTGAGAAGAGAGAGGAGGG + Intronic
1119270634 14:73301326-73301348 CAAGGTTGGAAGACTGAAGAAGG + Intronic
1119651747 14:76388818-76388840 CAAGCTGAGAAGAGGGAAGTCGG - Intronic
1121262628 14:92577486-92577508 CAAAGTGAAAACAGAGAAGATGG - Intronic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1124504727 15:30262733-30262755 TATGGTGACAAAAGTGATGAAGG - Intergenic
1124738825 15:32275902-32275924 TATGGTGACAAAAGTGATGAAGG + Intergenic
1124806283 15:32886683-32886705 CAAGGGGCCAAGAGACAAGAGGG + Intronic
1125740706 15:41962366-41962388 CAAAGTGACAATATTTAAGATGG + Intronic
1125803958 15:42476468-42476490 TAAGGTGACTAAAGTGAGGATGG - Intronic
1127136294 15:55927238-55927260 CAAGGTCACATGAGAAAAGAAGG + Intronic
1127484691 15:59408136-59408158 CAAGATGCCAAAAGGGAAGAAGG - Intronic
1128973243 15:72127775-72127797 TAAGGTGATAGTAGTGAAGATGG + Intronic
1129224776 15:74162685-74162707 GCAGGGGACAAGAGTGACGATGG - Intergenic
1130715767 15:86332137-86332159 CAATGTAACAACAGTAAAGAAGG + Intronic
1130766651 15:86877850-86877872 GAATGTGAGAAGAGAGAAGAAGG - Intronic
1131113180 15:89777735-89777757 TAAGGTGCCAAGAATGATGATGG - Intronic
1131288858 15:91087208-91087230 CCAGGTGGAAAGAGTGAAGGTGG - Intergenic
1132757021 16:1490491-1490513 CAAGGTGGCATGAGCCAAGAGGG + Intergenic
1133042415 16:3067684-3067706 CAGGGTGAGAAGGATGAAGAGGG + Intronic
1135734409 16:24919215-24919237 CAAGGTCGCAACAGTGAAAAAGG - Intergenic
1136629280 16:31479902-31479924 AAAGGTGACATGCGTGATGAAGG + Intergenic
1138844261 16:60546115-60546137 CAAGTTTACAAGATTGAAAATGG - Intergenic
1139567838 16:67790649-67790671 GCAAATGACAAGAGTGAAGAAGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141540079 16:84713392-84713414 CAGGGTGACAAGTGTGAAGGAGG - Intronic
1142912132 17:3103153-3103175 GCAGGTGACAAGACTGAGGAAGG + Intergenic
1145928339 17:28664939-28664961 TAAGGTGGTAAAAGTGAAGATGG - Intronic
1146529951 17:33600002-33600024 CAAGATGGCAGCAGTGAAGATGG - Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148391797 17:47278109-47278131 CAAAGAGAAAAGAATGAAGAGGG - Intronic
1149351921 17:55798253-55798275 CAATCTCATAAGAGTGAAGAGGG + Intronic
1150060990 17:62068090-62068112 CAAGGAGACAGAAGCGAAGAAGG + Intergenic
1150655705 17:67038047-67038069 CACGGTGACCAGCGTGCAGAGGG - Intergenic
1151175570 17:72285064-72285086 GAAGGTGACCACAGTGATGAGGG + Intergenic
1152395356 17:80029687-80029709 AAAGGAGACAAGAGGGGAGACGG - Intronic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1155411507 18:25550449-25550471 CAATGTGAAGAGAGTGAAAATGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155923441 18:31628937-31628959 CAAGGTGAAAGAATTGAAGATGG - Intronic
1157251158 18:46097545-46097567 CACTGTGACAACAGTGAAGCTGG - Intronic
1158038222 18:53060480-53060502 CAAGGTGTCCAGTGTGATGACGG + Intronic
1158581550 18:58688697-58688719 CAAGGAGATAAGAGACAAGAAGG - Intronic
1158748932 18:60236173-60236195 CAGGGTAACAACAGTGAGGATGG - Intergenic
1158940129 18:62400040-62400062 CAAGGTGGCAAGGGTGAAGTAGG - Intergenic
1159547636 18:69859663-69859685 CAAGGTAACAAAAATGAGGAAGG + Exonic
1162471070 19:10872128-10872150 CAAGGTGCCCAGAGTGAGCAAGG + Intronic
1163050320 19:14678379-14678401 GAAGGTGACGAAAGTGACGACGG + Intronic
1163986213 19:20953160-20953182 CAAGGTGCCAGGATTGCAGACGG - Intergenic
1164735219 19:30536186-30536208 AAAGGTGCCAAGGATGAAGAAGG - Intronic
1164821360 19:31253824-31253846 CAAAGGGACAGGAATGAAGAGGG + Intergenic
1164858627 19:31544904-31544926 CTAAGTGGCCAGAGTGAAGAGGG - Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165990745 19:39811671-39811693 CAAATTGACAAAAGTTAAGATGG - Intergenic
1166349031 19:42185609-42185631 CAGGGGGACAAGAGTGAGAAGGG - Intronic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1168715955 19:58527518-58527540 CAAAGTGACAGGACTGGAGAGGG - Intronic
926523622 2:13948930-13948952 CAAGGAGAAAAAAGTCAAGAAGG - Intergenic
928377215 2:30785248-30785270 CAAGGTGACATGATTAGAGAGGG - Intronic
929059941 2:37913885-37913907 GAAGGTGAAGACAGTGAAGATGG - Intergenic
930082176 2:47459880-47459902 CAAGATGAAAAGAATGAGGAAGG - Intronic
930640975 2:53854223-53854245 CAAGGTGGCAAGGGTGAAACTGG + Exonic
931663761 2:64595227-64595249 CAGGGTAGAAAGAGTGAAGAAGG + Intergenic
932529616 2:72515011-72515033 AAATGTGAGAAAAGTGAAGATGG + Intronic
933699853 2:85246844-85246866 CAAGTGGACAAGAGGGAAGGAGG - Intronic
934962314 2:98687503-98687525 GAAAGTGAGAAGAGGGAAGAAGG - Intronic
937455832 2:122040931-122040953 CAAGCTAACAAGAGAGAAAAAGG + Intergenic
937545587 2:123014686-123014708 CAAGATGAAAAGAGCGATGAAGG + Intergenic
938157906 2:128957191-128957213 CGAGGGGACAAGAGTCAGGATGG - Intergenic
939282916 2:140088484-140088506 CCAGGGGGCAAGAGTGAGGAAGG - Intergenic
939896082 2:147792775-147792797 AAAGGAGACAAGAGAGAAGGGGG + Intergenic
940376153 2:152961250-152961272 CAAGGTAACAGGATTCAAGATGG + Intergenic
941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG + Intronic
942072993 2:172332137-172332159 CAAGGTGGCAAGAATAGAGATGG + Intergenic
942097327 2:172546518-172546540 CCAGGTGACAGGAGTAAATAGGG + Intergenic
943526611 2:189024545-189024567 CAAGAGGAAAAGAGTGAAGGAGG - Intergenic
944937578 2:204585136-204585158 CAAGAAAACAAGAGGGAAGAGGG - Intronic
945418935 2:209610260-209610282 CAAGGTAACAGGAGAGGAGAGGG + Intronic
945582783 2:211616998-211617020 CATGGAAACAAGAGTGGAGATGG - Intronic
946284407 2:218692290-218692312 CAAGGTAACCAGAGTGGAGAAGG + Exonic
947993819 2:234510341-234510363 CAAGATGAAAAGAGTTATGAGGG - Intergenic
948667511 2:239545779-239545801 CCAGGTGACAGGAGGGAAGGCGG - Intergenic
1170487413 20:16832826-16832848 GAAGAAGAAAAGAGTGAAGAAGG - Intergenic
1170845540 20:19958955-19958977 CATGGTGGCATGAGTGAAGTGGG + Intronic
1171070483 20:22063283-22063305 GAAGGTGAAAAAAGTGAAGGTGG - Intergenic
1172393191 20:34580540-34580562 CAAGGTGTCAAGAATGAACTAGG - Intronic
1172432400 20:34903391-34903413 GAAGGGAACAAGAGTGAAGTGGG + Intronic
1172901227 20:38336305-38336327 GAGGTTGACAAGAGTGACGAAGG - Intronic
1174955368 20:55091916-55091938 CAAGGTCACATTAGTGAGGAAGG - Intergenic
1176927661 21:14769485-14769507 AAAGGTGACAATATTGAAAAGGG - Intergenic
1177419293 21:20835410-20835432 AAAGGTGACAAGAGTGTATGGGG - Intergenic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179374822 21:40841235-40841257 CAAGGTGGCAGGAGGGAAGCAGG - Intronic
1179410217 21:41156694-41156716 CAAGGTGTGAAGAGTGGATATGG + Intergenic
1180146846 21:45925899-45925921 CAAGTAGACAAGTGTGAAGAAGG + Intronic
1182642607 22:31780543-31780565 CATGGTGGCAAGAGAGAAGGTGG - Intronic
1182959093 22:34455299-34455321 GAAGCTGACACGTGTGAAGAAGG + Intergenic
1184299394 22:43547040-43547062 TAAGGTGTGAAGAGTAAAGAAGG + Intronic
1184326564 22:43792015-43792037 CATGGTGACAAAAGAGAAGCTGG + Intronic
950174108 3:10860457-10860479 GAAGAGCACAAGAGTGAAGATGG + Intronic
951007802 3:17638585-17638607 AAAAGTTACAAAAGTGAAGATGG - Intronic
951304588 3:21043031-21043053 CAGGGTGACATCAGTGAAAATGG - Intergenic
952985055 3:38771533-38771555 CAAGGTGATGAGGGGGAAGAAGG + Intronic
952988896 3:38813726-38813748 CAAGGTAAGAAGAGTGACCATGG + Intergenic
955096193 3:55800711-55800733 CAAGGAGAGAAAAGTGGAGATGG - Intronic
955744713 3:62128771-62128793 AAATATGACAACAGTGAAGAGGG - Intronic
958736583 3:98016317-98016339 CCAGGTGGCAGGGGTGAAGAAGG - Intronic
958797284 3:98719171-98719193 CTGGGTGACAAGAGTGAAACTGG - Intergenic
960243083 3:115368566-115368588 CATGGTGACTATAGTTAAGAAGG + Intergenic
960273334 3:115698642-115698664 TTAGGTGACAAGAGAGATGAGGG + Intronic
961225635 3:125243097-125243119 CTAGGTGAAAAGAGTAAACATGG - Intronic
961835948 3:129659744-129659766 CAAAATGGCAGGAGTGAAGATGG - Intronic
962336615 3:134537588-134537610 CAAGATGAGGAGAGTGAACATGG - Intronic
963789961 3:149573587-149573609 CAAGGTGACAATAGGGTAGCTGG + Intronic
964533724 3:157696510-157696532 CAAGGTGACTAGAGTGGATATGG - Intergenic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
965591097 3:170360463-170360485 CAAGGTGCCAACAGTTAAGAAGG + Exonic
965624149 3:170670305-170670327 AAAACTGACAAGAGTGATGATGG - Intronic
965765239 3:172123689-172123711 CAAGGTGATAAGAGTTTAAATGG - Intronic
965931501 3:174049084-174049106 CAAAGAGACAAGATTAAAGAAGG + Intronic
966471643 3:180296095-180296117 GAAGGTGACAAAAGTCAATAGGG + Intergenic
966483729 3:180444333-180444355 GAAGGTGAGAACAGTGAAGCTGG - Intergenic
967725676 3:192860192-192860214 CACGTAGCCAAGAGTGAAGAGGG - Intronic
969971921 4:11056667-11056689 AAATGTGACAAGAATGAAGAAGG + Intergenic
970323132 4:14895210-14895232 AAAAGTGACATGAGTGAAGTAGG + Intergenic
972000360 4:34024157-34024179 CAAAGTTACAAGAGTGCAGGAGG + Intergenic
972332985 4:38080732-38080754 TAAGGTGGCGAGAGTGCAGAGGG - Intronic
972487825 4:39559112-39559134 CATGGTCACAAGGGTGAAGTTGG - Intronic
973184543 4:47310275-47310297 TAAGGTCTCAAGAGAGAAGATGG - Intronic
974279839 4:59779069-59779091 CATGGTAACAAGGGGGAAGAGGG + Intergenic
975343281 4:73265161-73265183 ATAGGTGACATGAGTGAATAAGG - Intergenic
976993284 4:91397242-91397264 CATGATGACAAGAGAGAACATGG + Intronic
977148790 4:93481893-93481915 GAAGGTCAAAAGATTGAAGATGG + Intronic
977323919 4:95550752-95550774 GAAGATGAAGAGAGTGAAGAAGG - Intergenic
978357422 4:107891845-107891867 CATGGTGACAAAAAGGAAGATGG + Intronic
978581434 4:110235633-110235655 CAAGGTGGCAACAATGAAAATGG - Intergenic
978644768 4:110916885-110916907 CAACTTGACAAGAGAGAAAAAGG + Intergenic
979203565 4:118008044-118008066 CATGGTGATAAAAGTGAAGATGG + Intergenic
979853009 4:125596376-125596398 AGAGGTGACATGAGTGCAGAAGG + Intergenic
981019762 4:140013239-140013261 CAAGATGGCAAGGGTGAAGGCGG - Intronic
982537270 4:156622225-156622247 CAAGGTGACAGCAGTGCAGATGG + Intergenic
983612656 4:169666792-169666814 CAAGGTGTCAAGAGTTAAACAGG - Intronic
983996111 4:174184374-174184396 AGAGGTGACACGAGTAAAGAAGG - Intergenic
984441007 4:179770587-179770609 CAAGTTGAAAACAGTGGAGATGG + Intergenic
984705303 4:182843415-182843437 CAAGGGGAAGAGAGTGAACAGGG + Intergenic
985572810 5:659051-659073 AAAAGTGGCAAAAGTGAAGAGGG - Intronic
986120704 5:4833471-4833493 CAAGGGGACAACAGAGGAGATGG - Intergenic
986424249 5:7614605-7614627 CAGGGTGAGAAGAGTGACTATGG - Intronic
987274246 5:16345364-16345386 CAAGGAGGCAAGAATCAAGATGG - Intergenic
987432618 5:17854968-17854990 CCAGGTCACAAGGGTGAACAGGG - Intergenic
987502052 5:18724660-18724682 CAAGATGAAAAGAGTTAGGAAGG - Intergenic
987568708 5:19627097-19627119 CAAGGTGACACGATTGAACATGG - Intronic
987705056 5:21452587-21452609 CAAGGTCGTAACAGTGAAGATGG - Intergenic
988446009 5:31286828-31286850 CAGGGTGACAGCAGTGAAAATGG + Intronic
988714489 5:33811598-33811620 CAAGGAGACTAGAGAGAAAATGG + Intronic
989305044 5:39945204-39945226 TAAGGTAACAAGAATGAAGTGGG - Intergenic
991226165 5:64275659-64275681 CAGGGAGAAAAGAGAGAAGAAGG - Intronic
992861842 5:80919180-80919202 TAAGGTGAGAAGAGTGAGAAGGG + Intergenic
992983689 5:82204596-82204618 CAAGGAGAGATGAGTTAAGAGGG + Intronic
994944338 5:106366462-106366484 CAAAATGATCAGAGTGAAGAGGG + Intergenic
995394979 5:111677921-111677943 CAAGGTAAAAAGAGTTAAGAGGG - Intronic
995457569 5:112368381-112368403 CAAGGTGGCAATAGGGGAGAGGG - Intronic
996337521 5:122400962-122400984 TTGGGTGAGAAGAGTGAAGAGGG - Intronic
996386392 5:122913844-122913866 CAAGGTGCCAGGATTGCAGACGG - Intronic
996932678 5:128909025-128909047 CCAGCTGACAGTAGTGAAGATGG - Intronic
999523225 5:152374398-152374420 CAAGGTGGTAACAGTGAAGAGGG - Intergenic
999533528 5:152489418-152489440 CAAGGGGAGAAGGTTGAAGAAGG + Intergenic
1000565452 5:162841243-162841265 AGAGATGACCAGAGTGAAGAGGG + Intergenic
1001866722 5:175112680-175112702 AAAGGTGAAAAGAGTGAACGTGG + Intergenic
1002671823 5:180873690-180873712 CATGGTGACAAGACTGGAGGAGG - Intergenic
1004691564 6:17996600-17996622 CAAAGTGAGAAGAAAGAAGAAGG + Intergenic
1006384208 6:33720153-33720175 AAGGGTGACAGGAGTGGAGAAGG - Intergenic
1007114104 6:39331083-39331105 CAAGGTGCAAAGAGAGAAGCAGG - Exonic
1008753422 6:54764621-54764643 CAAGCTGAAAAAAATGAAGAGGG + Intergenic
1010827463 6:80490593-80490615 GAAGGTGACAAAATAGAAGATGG - Intergenic
1011596514 6:89021728-89021750 CAAGCTGAAAAGAGGCAAGAAGG + Intergenic
1011973517 6:93260828-93260850 GAAGGAGAAAAGAGAGAAGAAGG + Intronic
1012549360 6:100453515-100453537 CAAGGTGACAAGTGAGAAGTTGG - Intronic
1017559395 6:155610524-155610546 CTAGGTGACAGGAGTAAATAGGG - Intergenic
1017784885 6:157747482-157747504 CAAGCTGATATGAATGAAGATGG - Intronic
1019517418 7:1446173-1446195 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019517475 7:1446317-1446339 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019517514 7:1446423-1446445 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019631976 7:2054223-2054245 CAAAGAGCCAAGAGTAAAGATGG + Intronic
1020181449 7:5925603-5925625 CAAGGACACAACAGTGAGGAAGG - Intronic
1020301484 7:6799286-6799308 CAAGGACACAACAGTGAGGAAGG + Intronic
1020357580 7:7293805-7293827 AAAAATGACAAGAATGAAGATGG + Intergenic
1020837394 7:13170304-13170326 TAAGTTGATAAGAGTGAACAGGG - Intergenic
1022797842 7:33746402-33746424 CAAGGAGACAAGAGAGAGGTCGG + Intergenic
1023622794 7:42089814-42089836 CCAGGTGACATAAGTGAAGGTGG + Intronic
1024459924 7:49649428-49649450 CAAGAGCAAAAGAGTGAAGAGGG + Intergenic
1025828871 7:65033222-65033244 CAAGGTGCCAGGATTGCAGACGG + Intergenic
1026815132 7:73505047-73505069 CAGGCTGGCAAGAGAGAAGAGGG - Intronic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1027169933 7:75864448-75864470 GAAGGAGGCAAGAGTGAAAATGG - Intronic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1028332706 7:89615744-89615766 TAAGATGAGAATAGTGAAGAGGG - Intergenic
1030095532 7:105895195-105895217 CAAGGAGAGAAGAGAGAAGCAGG + Intronic
1030954379 7:115833955-115833977 TAGGGTGACAAGAGTGAAAAAGG + Intergenic
1031554233 7:123151877-123151899 CAGGGTGACAACAGTGGAGGTGG - Intronic
1031697270 7:124873914-124873936 CAAGGTGGCTACAGTGAAGATGG + Intronic
1032758376 7:134914220-134914242 GAAGGTGACAAGAATAAAAAAGG + Intronic
1032839113 7:135700156-135700178 CAAGGAGAAAAGAATGAGGAAGG - Intronic
1035308657 7:157951421-157951443 GAAGGTGCCAATAGGGAAGATGG - Intronic
1035339586 7:158151658-158151680 AAAGGAAACAAGAGGGAAGAAGG - Intronic
1035646408 8:1224935-1224957 CAAAGTGACAAGAGTTAGCAAGG + Intergenic
1036209707 8:6832363-6832385 TAAGGTGACAGGTGTGCAGATGG + Intronic
1036229727 8:6989666-6989688 CAAGGTAGGCAGAGTGAAGAGGG + Intergenic
1036232178 8:7008769-7008791 CAAGGTAGGCAGAGTGAAGAGGG + Intronic
1037788565 8:21917909-21917931 CAAGGTGTTAACAGTGGAGATGG + Intergenic
1039350511 8:36759026-36759048 GAAGGGGACAAGAGTGCAGGTGG - Intergenic
1040029765 8:42813806-42813828 GAAGTGGACACGAGTGAAGAGGG - Intergenic
1041120251 8:54579427-54579449 CAACGTGACAAGAGAGGAGTTGG - Intergenic
1042320996 8:67475479-67475501 TGAGGGTACAAGAGTGAAGAGGG + Intronic
1044081970 8:87896672-87896694 CATGGTGCCAAGAGACAAGAAGG + Intergenic
1044132877 8:88548346-88548368 GAAAGTGACAAAAGTGAAGATGG - Intergenic
1044371790 8:91420526-91420548 CATGGTGACTAGCTTGAAGAAGG + Intergenic
1044602967 8:94024311-94024333 CAAGGTTACCAGGATGAAGAAGG + Intergenic
1045184478 8:99823177-99823199 CAAGGTCACAAAGATGAAGAGGG - Intronic
1045731037 8:105241079-105241101 GAAGGTGAAAAGACAGAAGATGG - Intronic
1046021082 8:108665690-108665712 CAAGATGGAAAGAGAGAAGAGGG + Intronic
1046025755 8:108721584-108721606 CAAAGTGACTGGAGTGAGGATGG - Intronic
1047210397 8:122835698-122835720 CAGGGTGGCAAGAATGGAGAAGG + Intronic
1048523009 8:135174354-135174376 CAAGGAGACAAGAGTAGAAATGG + Intergenic
1048612045 8:136033589-136033611 CAGGGTGAAAAGAGTCAAGCAGG - Intergenic
1048627340 8:136199748-136199770 TTAGGTGACAAGAGTAGAGAAGG + Intergenic
1048748103 8:137637965-137637987 CAAAGGGAGAAAAGTGAAGATGG - Intergenic
1048758105 8:137761168-137761190 AAAGGTGAGAAAAGTGAAGGCGG - Intergenic
1049569617 8:143363003-143363025 CACGGTAACAGGAGAGAAGATGG - Intergenic
1049917272 9:330231-330253 CAAGGAAAGAAGAGTGAAAATGG + Intronic
1051040089 9:12798481-12798503 AAAGGTGAAAAGAATGAAGAAGG - Intronic
1051047751 9:12895506-12895528 CATGGAGACAAGAGAGTAGAAGG + Intergenic
1051148025 9:14049784-14049806 CAAGGTGTCAACACTGGAGAAGG + Intergenic
1051326205 9:15972282-15972304 TGAGCTGACAAGAGAGAAGAGGG - Exonic
1052394844 9:27926638-27926660 TAAGGTAAGAAGAGTGAAGCAGG + Intergenic
1053463083 9:38285576-38285598 CAAGGTGAGGAGAATGAAGAAGG - Intergenic
1054146827 9:61568352-61568374 CTGGGTGACAAGAGTGAAACTGG + Intergenic
1054729284 9:68684544-68684566 CAAAGTGACAAGAGACACGATGG + Intergenic
1055423343 9:76167126-76167148 CACAGTGACAAGGATGAAGATGG - Intronic
1056250921 9:84747115-84747137 CAAGGCCACAAGAGTGGAAATGG + Intronic
1056277068 9:85003792-85003814 CTAGGTGTCAACAGTGAAGATGG + Intronic
1057753500 9:97810755-97810777 CAAGGTGGTAAGAGTGAGAAGGG + Intergenic
1057953267 9:99386602-99386624 GAAGGAGTCAAGAGAGAAGAAGG + Intergenic
1058244307 9:102604005-102604027 CGAGGTGCCAGGAGTGCAGACGG - Intergenic
1058411438 9:104737541-104737563 CAAGATGAAAAGAGTTATGAAGG + Intergenic
1059742903 9:117170403-117170425 CTAGGTGACAACACTGATGAAGG + Intronic
1059771025 9:117425793-117425815 CAAGGTGACAGGAGCAAAGCAGG + Intergenic
1059955849 9:119515292-119515314 CAAGGTGGCAAGAGTGTATAAGG + Intronic
1060289193 9:122284733-122284755 CAATGTGACAAGAGTGTACAAGG - Intronic
1061407520 9:130400677-130400699 CAAGGTGACATCAGTGACAAAGG - Intronic
1061511747 9:131065792-131065814 CAAGATGACAATGGTGATGAAGG + Intronic
1061887070 9:133596502-133596524 GAAGGTGACACCAGTGATGAAGG + Intergenic
1061917836 9:133764804-133764826 CAAGGAGAAAAGAGAGAAAATGG + Intronic
1185889045 X:3808206-3808228 CACGGTGACAAAAGGGAAGATGG + Intergenic
1185912338 X:3993844-3993866 CAAAGTGAGAAGACTGAAGTAGG + Intergenic
1189797106 X:44655680-44655702 CAAGGAAACAAGAGTTCAGATGG - Intergenic
1189942094 X:46135144-46135166 TGAGGTGAAAAGAGTGAAAAGGG + Intergenic
1191010572 X:55753606-55753628 AAAGTTGACAAGAGGGAAAAAGG - Intronic
1192369606 X:70502328-70502350 CATGGGGACAGGAATGAAGAGGG - Exonic
1193164742 X:78266174-78266196 CAAGGTGCCAGGATTGCAGACGG - Intergenic
1194806717 X:98338172-98338194 CAAGGTGACAAAGGTGAAGATGG - Intergenic
1195388503 X:104336368-104336390 CAAGGTCTGAAGAGTCAAGAAGG - Intergenic
1196138388 X:112234309-112234331 CAAGGGGATAAGAGTGTATAAGG - Intergenic
1196193229 X:112815357-112815379 GAAGGTGGCAAGACTGCAGAAGG - Exonic
1196728370 X:118917684-118917706 CAAGCTGACAAGACTGAAGGTGG - Intergenic
1196746141 X:119073165-119073187 TGAGGTGACAACGGTGAAGACGG - Intergenic
1197339685 X:125251293-125251315 AAAGGTGAAAATAGTGTAGAAGG - Intergenic
1198077980 X:133212769-133212791 CTGGGTGACAAGAGTGAGGCGGG + Intergenic
1201320620 Y:12694294-12694316 CCAGGTGATAAGAGTAAACAGGG - Intergenic
1201891057 Y:18944561-18944583 GAAGGTGAGGAGAGTGAAAAGGG - Intergenic