ID: 909010893

View in Genome Browser
Species Human (GRCh38)
Location 1:70333833-70333855
Sequence GTGGGAACCAAGATGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909010893_909010898 -3 Left 909010893 1:70333833-70333855 CCTCCAAACATCTTGGTTCCCAC 0: 1
1: 0
2: 4
3: 10
4: 149
Right 909010898 1:70333853-70333875 CACTCTTCCTGAGACCTGGCTGG 0: 1
1: 0
2: 2
3: 32
4: 241
909010893_909010895 -7 Left 909010893 1:70333833-70333855 CCTCCAAACATCTTGGTTCCCAC 0: 1
1: 0
2: 4
3: 10
4: 149
Right 909010895 1:70333849-70333871 TTCCCACTCTTCCTGAGACCTGG 0: 1
1: 0
2: 6
3: 35
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909010893 Original CRISPR GTGGGAACCAAGATGTTTGG AGG (reversed) Intronic
905506832 1:38486445-38486467 CTGTGAACCAAGATGTTTGGTGG - Intergenic
906739048 1:48163207-48163229 GTGGGAATCAAGTAATTTGGGGG + Intergenic
909010893 1:70333833-70333855 GTGGGAACCAAGATGTTTGGAGG - Intronic
910771256 1:90834982-90835004 GAGGGAGCCAAGCTGTTAGGCGG + Intergenic
914817838 1:151076229-151076251 GTTGGAACCAAGCTGATTTGGGG + Intronic
914990612 1:152496730-152496752 ATAGGAGTCAAGATGTTTGGGGG - Intergenic
916583216 1:166126903-166126925 ATGGAAACCAAGATGTTTCATGG + Intronic
917095320 1:171393651-171393673 ATGGGAACCAATGTGTTTTGGGG + Intergenic
918523124 1:185436654-185436676 GTTGGAACAAAGCTGTTTTGTGG + Intergenic
921297183 1:213715172-213715194 GTCGGAAGCAGGATGTGTGGTGG + Intergenic
922619595 1:226981665-226981687 GTGGGAACCAAGAGGGATGTAGG - Intronic
923225577 1:231936132-231936154 GTAGGAACCAGAATGTTGGGAGG - Intronic
1063592288 10:7406965-7406987 GTGGGGACCTAGAGGGTTGGCGG + Intronic
1064440810 10:15351728-15351750 GTGGGAACATAGCTGTTTTGTGG - Intronic
1065386312 10:25136983-25137005 GGGGGAAGAAAGATGTTGGGGGG + Intergenic
1065801751 10:29358695-29358717 TTGGGAGCCAGGAAGTTTGGGGG + Intergenic
1069637374 10:69933491-69933513 GTGAGAGACAGGATGTTTGGTGG + Intronic
1070556369 10:77530966-77530988 GTGGGATGCAAGATGCTTTGAGG - Intronic
1071021759 10:81065359-81065381 GGGGCAATCAAGGTGTTTGGTGG - Intergenic
1071066844 10:81645944-81645966 GTGGGAAGCAAGAGCATTGGAGG - Intergenic
1072315117 10:94194923-94194945 GAGGCTACCAAGAAGTTTGGGGG + Intronic
1073301648 10:102474611-102474633 GTTGGAAGCAAGCTGTTGGGAGG + Intronic
1073437537 10:103528874-103528896 GTTGGAACCAAGCTGATTTGGGG + Intronic
1074296705 10:112195867-112195889 GTGGGAACCACAGAGTTTGGGGG + Intronic
1075661929 10:124203384-124203406 GTTGGAACCAAGATGTTGGCTGG - Intergenic
1076648600 10:131971704-131971726 GGGTGTACCCAGATGTTTGGTGG - Intronic
1077607411 11:3621387-3621409 GTGGGAACCTGGCTGGTTGGCGG + Intergenic
1080024603 11:27600266-27600288 GTGTGGACCCAGATGCTTGGTGG - Intergenic
1081651051 11:44824423-44824445 GAGGAAACCAAGCTGTGTGGGGG + Intronic
1083583430 11:63839466-63839488 GAGGGAACCGAGAAGCTTGGAGG - Exonic
1083966016 11:66044218-66044240 GTTGCAACCAAGGTGTTTGCTGG - Intronic
1085076604 11:73597718-73597740 GTGGGACCCAAGCAGGTTGGGGG - Intronic
1087684165 11:101244788-101244810 CTGGGAAGCAAGGTGATTGGAGG + Intergenic
1088298760 11:108331507-108331529 ATGGGGACCAAGATGATGGGAGG + Exonic
1092086619 12:5768163-5768185 GTAGGAACAAAGATATTTTGGGG - Intronic
1096564498 12:52467303-52467325 GTGGGAGCCAGAATGTTAGGGGG + Intergenic
1101154546 12:101915339-101915361 GTGTGAATGAAGGTGTTTGGTGG + Intronic
1101634280 12:106524885-106524907 GTGGGAGCCAATGAGTTTGGGGG + Intronic
1104706118 12:130948809-130948831 GTTGCAACCATGATGGTTGGAGG + Intergenic
1105407507 13:20144358-20144380 GTGGGTACCCAGATGTCTGAGGG + Intronic
1105940862 13:25146693-25146715 ATCCCAACCAAGATGTTTGGTGG - Intergenic
1106596855 13:31150269-31150291 GTGGGATCCAAGGTGTCTGAGGG - Intronic
1106653350 13:31716116-31716138 GTTGGAACCAAGCTGCTAGGGGG + Intergenic
1106936067 13:34721646-34721668 GTGGTAACCAAGACCATTGGAGG - Intergenic
1107105259 13:36636302-36636324 GTGAGAAACATGAGGTTTGGAGG - Intergenic
1112770306 13:102788023-102788045 GTGGGAAATAATATCTTTGGGGG + Intronic
1114161016 14:20167574-20167596 CTGGGAAGAAAGATGTGTGGAGG + Intergenic
1116962061 14:50977023-50977045 GTGGGAACCAAGTGACTTGGTGG + Exonic
1119999524 14:79286728-79286750 GTGGGAACAACTATGGTTGGAGG + Intronic
1120395539 14:83962597-83962619 GTGGGAATCACCATGTTGGGTGG + Intergenic
1122768788 14:104087880-104087902 GTGGGAAACAAGAGACTTGGAGG + Intronic
1126689596 15:51278995-51279017 GTAGGATGCAAGATCTTTGGAGG + Intronic
1128708037 15:69851632-69851654 TAGGGAACCAAGATGTGGGGTGG - Intergenic
1129295237 15:74596505-74596527 GTGGGGAGCATGAGGTTTGGCGG - Exonic
1129454917 15:75671581-75671603 GTGGCCACCAAGATAATTGGTGG - Intergenic
1130922016 15:88355265-88355287 GTGGGAATAAAGAGGATTGGTGG - Intergenic
1132589821 16:721761-721783 GTGGGAACCAGGATGTGGGCAGG - Intronic
1132789698 16:1678618-1678640 CTGGGAACAAAGCTGTGTGGAGG + Intronic
1134043362 16:11084348-11084370 GTGGGTACCAAGCTGCTTGGGGG + Intronic
1134825588 16:17281785-17281807 GTGGCACCCAAGATGATTTGCGG - Intronic
1134890253 16:17835240-17835262 CTGTGAACCAACATGGTTGGTGG - Intergenic
1137552829 16:49452377-49452399 TTGGGAACCCTGATGTCTGGGGG - Intergenic
1138337639 16:56265752-56265774 GTGGGAGGCAAGATGGTTTGGGG + Intronic
1143787675 17:9268253-9268275 GTGGGCACCATGAAGATTGGTGG + Intronic
1144194619 17:12878321-12878343 GTGGCAATCAAGATTTTTGTGGG + Intronic
1144482401 17:15638804-15638826 GTGGGAACCTAGAGGTTTGGAGG + Intronic
1144916282 17:18726228-18726250 GTGGGAACCTAGAGGTTTGGAGG - Intronic
1147178007 17:38668813-38668835 ATGGGAACCAAGTTGGTTGAGGG + Intergenic
1151961345 17:77407595-77407617 GTGGGCACCTAGATGGTTGAAGG + Intronic
1155943849 18:31826002-31826024 GTGGGAATCACCATGTTTGGGGG + Intergenic
1157385387 18:47255711-47255733 GAGGGAACCAAGTTCTCTGGAGG + Intergenic
1158466313 18:57693361-57693383 CTGGTAACTTAGATGTTTGGAGG + Intronic
1158990069 18:62859224-62859246 GAGAAAACCAAGATGTGTGGAGG + Intronic
1160147490 18:76377014-76377036 GTGGAAAACAAGTTGGTTGGTGG - Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1161447246 19:4325388-4325410 ATGAGAACCAAGATGGTGGGTGG - Exonic
1162318962 19:9959766-9959788 TTGGGGACCAAGATGTTGGGGGG - Exonic
1163967308 19:20758792-20758814 GGGGGACCCAATATATTTGGGGG - Intronic
1165330779 19:35140240-35140262 TGGGGTACCAAGAAGTTTGGGGG + Intronic
1168718082 19:58540565-58540587 GTGGGAAGCAGGGTGTGTGGGGG - Intergenic
1168718113 19:58540682-58540704 GAGGGAAGCAGGATGTGTGGGGG - Intergenic
926596204 2:14791910-14791932 ATGGAAACCAAGATGTTTTCGGG - Intergenic
932625456 2:73292846-73292868 GTGGGCACCAAGAGTTTTGTAGG - Intronic
938194458 2:129314627-129314649 ATGGGACCCAAGATTGTTGGAGG - Intergenic
939218402 2:139270758-139270780 CTGGTAAACAACATGTTTGGAGG + Intergenic
939918658 2:148081208-148081230 GAGGGAATGAAGAAGTTTGGAGG - Intronic
946877982 2:224149473-224149495 GTGGAAAGCAAGATGTTTTAAGG + Intergenic
1171092107 20:22295040-22295062 TGGGGAACCAAGATGGATGGAGG - Intergenic
1171202747 20:23255138-23255160 GTGGGAACCAAGATGGGAGTGGG + Intergenic
1173310797 20:41894610-41894632 GTGGGAGCCAAGGTCTCTGGTGG + Intergenic
1173426851 20:42950596-42950618 GTGGTAACCAAGATGGTGGACGG + Intronic
1177332663 21:19682843-19682865 GTGGGAATCACCATGTTGGGTGG - Intergenic
1178472402 21:32905173-32905195 GTGGGAGACAAGATGCTGGGAGG - Intergenic
1180824755 22:18854718-18854740 GTGGGAATCAAGATTTTCTGAGG - Intronic
1181125173 22:20697869-20697891 GTGGGAATCAAGATTTTCTGAGG - Intergenic
1181187975 22:21119829-21119851 GTGGGAATCAAGATTTTCTGAGG + Intergenic
1181211223 22:21290664-21290686 GTGGGAATCAAGATTTTCTGAGG - Intergenic
1181398281 22:22636224-22636246 GTGGGAATCAAGATTTTCTGAGG + Intergenic
1181651133 22:24259836-24259858 GTGGGAATCAAGATTTTCTGAGG - Intergenic
1181706247 22:24650903-24650925 GTGGGAATCAAGATTTTCTGAGG + Intergenic
1185301664 22:50084174-50084196 GTGGGCACAGAGATGATTGGAGG - Intronic
1203215726 22_KI270731v1_random:4767-4789 GTGGGAATCAAGATTTTCTGAGG + Intergenic
1203274901 22_KI270734v1_random:80624-80646 GTGGGAATCAAGATTTTCTGAGG - Intergenic
950796790 3:15516651-15516673 GTGTCAACCAGGGTGTTTGGGGG - Intronic
951314433 3:21171299-21171321 GTGGGACCCCAAATCTTTGGTGG - Intergenic
951506623 3:23453308-23453330 GTTGGAAACAATATGTTTGGAGG + Intronic
952181067 3:30917315-30917337 GTGGAACACAAGATATTTGGGGG - Intergenic
954085921 3:48243864-48243886 GTGGCAAAGAAGATGTTTTGTGG + Intronic
956359393 3:68430708-68430730 GTGGGTAACAACATGTGTGGAGG - Intronic
956613802 3:71151374-71151396 GTGGGAACAAAGTTGTATTGGGG + Intronic
957539526 3:81550079-81550101 GTTGGAACCAAGCTGTTATGGGG - Intronic
962204137 3:133421328-133421350 CTGGAAACCAAGATGTTAGCAGG + Intronic
963278262 3:143354599-143354621 GTAGGAGCCAAGATATTTGCAGG - Intronic
963918367 3:150881972-150881994 GTGGGAACCAGGAGGGCTGGAGG + Intronic
968894376 4:3390132-3390154 GTGGGACGCAGGATGGTTGGGGG - Intronic
971756585 4:30716790-30716812 GTAGGAAGCAAAATGTTTGAGGG - Intergenic
972559817 4:40216626-40216648 GTGGGAAACAAGATCTTTTTAGG + Intronic
973262106 4:48175515-48175537 GTGGGAACCAAGATACTGGCAGG + Intronic
974614265 4:64261671-64261693 GTTGGAACCAAGATGTTATAGGG + Intergenic
975846318 4:78529085-78529107 GTGGTGAACAAGCTGTTTGGAGG + Intronic
981815628 4:148827888-148827910 GTGGGAAGTAATAAGTTTGGGGG + Intergenic
989793343 5:45434443-45434465 GTAGGAATCAAGATGGATGGTGG + Intronic
991479827 5:67065937-67065959 GTGGCAACCCAGAAGTTTAGAGG + Intronic
991659256 5:68933847-68933869 CTGGGAAACAAGATAGTTGGAGG - Intergenic
997593518 5:135091067-135091089 GTGGGAACAAAGATGTGAGGTGG + Intronic
999432813 5:151538594-151538616 GTGGAAACCATGATGCTTGCAGG - Intronic
1004243241 6:13947092-13947114 GTGGGAACCAAGCTGATATGGGG + Intronic
1005290445 6:24374213-24374235 GTTGGAATCTAGATGTTTGTTGG + Intergenic
1005896152 6:30181250-30181272 CTGGGAACTAAGATGCTAGGTGG + Intergenic
1005949208 6:30618811-30618833 CTTGGAACTAAGATGTGTGGTGG - Intronic
1008952563 6:57176505-57176527 ATGGTAATGAAGATGTTTGGGGG + Intronic
1009683019 6:66923423-66923445 GTGGGAACCACCATGTTTGGTGG - Intergenic
1009808096 6:68628415-68628437 GTGGCAACCAGGATGTTGGCTGG + Intergenic
1012035014 6:94124581-94124603 GTGGTAACCACAATGTTTGTTGG - Intergenic
1018357322 6:163031299-163031321 GTTGGAACCAAGCTGGTAGGGGG + Intronic
1018828158 6:167423281-167423303 GGGGGAACCATGGTGTGTGGGGG - Intergenic
1022622615 7:32000373-32000395 GAGGGAAACAAGATGGTTGGGGG + Intronic
1024524197 7:50334796-50334818 GTGGGATGCATGATGTGTGGTGG + Intronic
1026319723 7:69258172-69258194 GTGGGAGCCAGGGTGTTTGTGGG - Intergenic
1032694221 7:134319937-134319959 GAAGGCACCAAGATGTTAGGAGG - Intergenic
1033153424 7:138936384-138936406 GTGGGAAGGAAGATGTGTGAGGG - Intronic
1033574798 7:142670662-142670684 GTGGGACCCAGGAAGTTTGCAGG + Intergenic
1037377236 8:18244105-18244127 GTTGTAATCAAGATGTTGGGTGG + Intergenic
1038242405 8:25822089-25822111 GTGGGAAACAAGAGCATTGGTGG + Intergenic
1039165167 8:34670922-34670944 GGGGGAAGCAGGATGTTTAGGGG - Intergenic
1039446036 8:37633112-37633134 GTGAGGAGCAAGATGTTTGGAGG + Intergenic
1039917851 8:41872860-41872882 GTGGGAAGCCAGATGTGGGGTGG - Intronic
1040401745 8:47057334-47057356 GTGGGAACCACCATATTGGGTGG + Intergenic
1041515097 8:58691335-58691357 CTGGGAAGCGAGATGATTGGTGG + Intergenic
1042985630 8:74580087-74580109 GTGTGAATCAAGATGTTAGATGG + Intergenic
1043467701 8:80528729-80528751 CTAGGAACCAGGGTGTTTGGTGG - Intergenic
1044291838 8:90481096-90481118 GTGTGAACAAAGATTTTTTGAGG + Intergenic
1047637508 8:126780525-126780547 GTGGAAACATAGATGTTTGTAGG - Intergenic
1050169023 9:2796114-2796136 GGGGGATTCAAGTTGTTTGGTGG - Intronic
1052887263 9:33662088-33662110 GTGGGACCCAGGAAGTTTGCAGG + Intergenic
1053140188 9:35677533-35677555 GTGCGAACCAACAAGCTTGGTGG - Intronic
1057564059 9:96152813-96152835 GTGGGAACCAAGATTCTTTGGGG + Intergenic
1060215615 9:121736684-121736706 GGGGGAACCAAAAGATTTGGGGG - Intronic
1186670592 X:11764022-11764044 GTGTGGGCCAACATGTTTGGAGG + Intronic
1190869617 X:54414148-54414170 GTCTGAACCCACATGTTTGGTGG - Intergenic
1191217796 X:57951522-57951544 GTGTGAACTCAGCTGTTTGGTGG - Intergenic
1195070195 X:101271855-101271877 ATGAAAACAAAGATGTTTGGTGG + Intronic
1196180886 X:112688321-112688343 GTGGGAAACAGGGTGGTTGGAGG - Intergenic
1198439221 X:136645778-136645800 GTGGCAACCAAGGTTTTTGGAGG + Intergenic