ID: 909021609

View in Genome Browser
Species Human (GRCh38)
Location 1:70437539-70437561
Sequence CCACATAGGCAGTATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909021609 Original CRISPR CCACATAGGCAGTATGTGGA AGG Intronic
900403412 1:2482240-2482262 GCACATAGCCACTCTGTGGAGGG + Intronic
900688625 1:3965789-3965811 CCACATAGGCAGTGTGGCCAGGG - Intergenic
904917065 1:33977712-33977734 CCACAGGGTCAGCATGTGGAAGG - Intronic
908167022 1:61468736-61468758 CCAAAGAGGCAGAACGTGGATGG - Intergenic
908633006 1:66130962-66130984 CCATGTAGGCAATATGTGGTGGG + Intronic
909021609 1:70437539-70437561 CCACATAGGCAGTATGTGGAAGG + Intronic
911646288 1:100340605-100340627 TCTCATAAGCAGTAAGTGGAGGG + Intergenic
912580458 1:110716616-110716638 TCACACAGTCAGTATGTGGTAGG + Intergenic
912652363 1:111450477-111450499 TCACACAGCCAGTAAGTGGAGGG - Intronic
914447538 1:147762531-147762553 CCAGAAAGGCAGTATTAGGAAGG + Intronic
915626708 1:157118378-157118400 CCTCACAGGCAGTAAGTGGCAGG + Intergenic
918151683 1:181802433-181802455 CCACATAGGCTCTATGGGGTTGG - Intronic
919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG + Intergenic
920818021 1:209353657-209353679 TCACATAGGCAGTAAGTAGCAGG + Intergenic
1064158839 10:12925963-12925985 CCACAAAGGCAGAATTTGTAGGG + Intronic
1064959336 10:20946183-20946205 CCTCATAGGCTGTATGAGCAAGG + Intronic
1068351071 10:55845921-55845943 CCTCCTAGGCAGTGTGTGGGGGG - Intergenic
1069303626 10:66940207-66940229 CCACATAGGCTGGGTGTGGTAGG + Intronic
1070010587 10:72470169-72470191 TCACATAGCCAGTAAGTGGTGGG + Intronic
1079150455 11:17894422-17894444 GCACATAGCTAGTAAGTGGATGG + Intronic
1081447054 11:43140727-43140749 CCACACAGCAAGTATGTGGTAGG - Intergenic
1081625376 11:44652193-44652215 CCAAACAGGCAGACTGTGGAAGG + Intergenic
1083191290 11:61054136-61054158 CCTCAAAGACAGTATGTGGATGG + Intergenic
1085796015 11:79540699-79540721 CCACACAGGCAGCATGGGAATGG - Intergenic
1088768135 11:113005302-113005324 CCACAGAGACCCTATGTGGATGG + Intronic
1089780015 11:120867101-120867123 CCACAGAGACAGTAGCTGGAAGG - Intronic
1090466408 11:126938461-126938483 TCACATAGGTAGTAAGTGGTAGG + Intronic
1095992040 12:48041832-48041854 CCACAAAGGAAGTATGTGTAAGG + Intergenic
1096072467 12:48782891-48782913 CCACATAGGCAGGCTGAGGGCGG + Exonic
1098171421 12:67750988-67751010 CCACAAAGGCAGCATTTGGAAGG + Intergenic
1101776936 12:107804324-107804346 CCACAAAGACACAATGTGGAAGG + Intergenic
1101814592 12:108136220-108136242 CCACATAGACAGTAGGAGGCAGG + Intronic
1102522431 12:113486920-113486942 CCACAGAGGCAGCAGGTGTAGGG - Intergenic
1104861668 12:131927476-131927498 CCACATGGCCAGTGTGTGCAGGG - Intergenic
1106419932 13:29577688-29577710 CCACATAGCCTGTACTTGGACGG + Intronic
1107771794 13:43794627-43794649 CTGCAGAGGCAGTATGTAGATGG - Intergenic
1116231415 14:42222801-42222823 ACACACACGCAATATGTGGAGGG - Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1131379948 15:91955225-91955247 CCACATAGCCAAGATGTGGTAGG + Intronic
1133239264 16:4404828-4404850 CCACATGGACAGTGTGTGGCAGG - Intronic
1133489295 16:6251393-6251415 TCACACAGTCAGTGTGTGGAGGG + Intronic
1134635426 16:15788162-15788184 ACATAGAGGCAGTATCTGGATGG - Intronic
1135197019 16:20403111-20403133 GCACACAGGGAGAATGTGGAGGG - Intronic
1136014562 16:27387353-27387375 GCACATAGCCAGTAAGTGGCGGG - Intergenic
1137814253 16:51383340-51383362 CCAGATAGGAAGAATGTGGTAGG + Intergenic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1142969961 17:3604669-3604691 CCACATACACATGATGTGGACGG + Intergenic
1147663800 17:42132483-42132505 GCACATAGGCACTGTGAGGAAGG - Intronic
1148678175 17:49457169-49457191 CCACAGAGACTGGATGTGGAGGG - Intronic
1149672147 17:58424116-58424138 CCACATAAGTATTTTGTGGAAGG + Intronic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1158140443 18:54249977-54249999 CCAAGTATGCAGAATGTGGAAGG - Intergenic
1158441678 18:57480114-57480136 CCACATAGGGGGAATGAGGAGGG - Exonic
1162502208 19:11060336-11060358 TCACACAGCCAGTATGTGGCAGG + Intronic
1165689766 19:37854505-37854527 CCACACAGCCAGAATGTGGCAGG + Intergenic
1167353575 19:48990698-48990720 ACACACAGGCAGCAAGTGGAGGG + Intronic
1168644488 19:58051397-58051419 TCACGTTGGGAGTATGTGGATGG - Intronic
925063982 2:914954-914976 ACACACAGGCAGTAGATGGAAGG + Intergenic
925980960 2:9177113-9177135 TCACATAGACAGTAAGTGGCAGG + Intergenic
928219231 2:29389426-29389448 CCACATAGACAGTGTGTGTTTGG + Intronic
929379350 2:41332199-41332221 CCACAGATGCAGTATGATGAGGG + Intergenic
930231147 2:48845067-48845089 TCACAAAGTCAGTATGTGGTGGG - Intergenic
932586743 2:73035013-73035035 TCACATAGCTAGTATGTGGTGGG - Intronic
932770045 2:74495851-74495873 CCAGAGAGGCAGTATTTAGAAGG + Intergenic
936918126 2:117660963-117660985 CCAAATAGGCAATCTGAGGAGGG - Intergenic
939116085 2:138062418-138062440 CCACAGGAGCAGTAAGTGGAAGG + Intergenic
940639401 2:156331587-156331609 CCAGAAAGGCAGATTGTGGAAGG - Intronic
942087464 2:172456636-172456658 CAACATAGCCTGTGTGTGGAAGG + Intronic
942745068 2:179222278-179222300 CCACATAGCTAGTAAGTGGCTGG - Intronic
943536789 2:189162091-189162113 CCTCTCAGGCAGTATGTGGGAGG + Intronic
945005916 2:205405817-205405839 ACACATACACAGGATGTGGAAGG + Intronic
945326323 2:208486705-208486727 CCACATAGGCAGTGGTGGGAAGG + Intronic
945403842 2:209422461-209422483 AATCATAGACAGTATGTGGATGG - Intergenic
946405279 2:219489033-219489055 CCCTATAGGCAGTATGGGGGAGG - Exonic
946792175 2:223312338-223312360 CCAGATAGGCATGATGGGGAGGG - Intergenic
948327514 2:237137859-237137881 CCACACAGGCAGAATGTTGAGGG - Intergenic
948405880 2:237718493-237718515 CCACATAGGGAGGCTGCGGAAGG + Intronic
948507612 2:238440470-238440492 CAACACAGGCAGTATGTGGAGGG - Intronic
948919191 2:241053369-241053391 CCACATGGCCAGGATGAGGAGGG - Intronic
1169858574 20:10129118-10129140 CTACATAGACAGGTTGTGGAGGG + Intergenic
1170401809 20:15993941-15993963 CCACAGAGGGATTATCTGGAGGG + Intronic
1170970058 20:21106938-21106960 CCACATTTGTAGTATGTGAAAGG - Intergenic
1173015834 20:39224814-39224836 CCACACAGCTAGTAAGTGGAGGG - Intergenic
1174358528 20:50014145-50014167 CCACAGTGGCAGTAGCTGGACGG - Intergenic
1177630002 21:23714546-23714568 CCACTTAGGTGGTCTGTGGATGG - Intergenic
1178243450 21:30928954-30928976 TCACATAGGCAGTATATAGTAGG - Intergenic
1179426231 21:41280644-41280666 CCACATCTGCGGAATGTGGAAGG + Intronic
1179496317 21:41773567-41773589 CCACAGAGGCAGCAAGTAGATGG + Intergenic
1179722479 21:43323631-43323653 CCACATGGGCAGCATGTGGCTGG - Intergenic
1180930200 22:19585014-19585036 CCCCATAGGCAGTGTGCTGAGGG - Intergenic
1181600900 22:23951407-23951429 ACACAGAAGCAGTCTGTGGAGGG + Intergenic
1181607613 22:23989919-23989941 ACACAGAAGCAGTCTGTGGAGGG - Intergenic
1183016958 22:34996695-34996717 CAGCACAGGCACTATGTGGATGG + Intergenic
950718807 3:14868068-14868090 ACACAAAGGCTGTAGGTGGAAGG + Intronic
955951616 3:64248440-64248462 CCACATATGCAGTAAGTTGCAGG + Intronic
956144258 3:66176378-66176400 ACACAGAGGAAGTGTGTGGATGG + Intronic
956759086 3:72421986-72422008 CCTTATAGGCAGTATGTAGTTGG - Intronic
967147517 3:186618538-186618560 CCACATAGGTAGAAGGTGGGAGG - Exonic
967200782 3:187070744-187070766 CAACAGAGGTAGTATGAGGATGG - Intronic
967402234 3:189076077-189076099 CCACATGGTTAATATGTGGAAGG + Intronic
968079958 3:195839215-195839237 CCACTTAGGGAGCATGGGGAGGG - Intergenic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
970490272 4:16565158-16565180 CCAGATAGCCAGTAAGTGGTAGG - Intronic
972985442 4:44757989-44758011 CCACAAAGGTGGTATGTGGTAGG - Intergenic
980991315 4:139740895-139740917 CCAGAAAGGCAGCTTGTGGAAGG - Intronic
984691911 4:182735699-182735721 CTACATAGGCTGTAAGTGCAAGG - Intronic
986860604 5:11922587-11922609 CTACATAGTCATTATGTTGATGG - Intergenic
989717310 5:44479426-44479448 CCACATATGCACTATGAGGATGG + Intergenic
990224405 5:53632975-53632997 CCACATATGTAGTATGTCAAGGG - Intronic
991450510 5:66745972-66745994 GCACATAGGCAGTAGGTTGTGGG + Intronic
992368239 5:76115182-76115204 CCACTGAGGTAGTATATGGATGG + Intronic
994577180 5:101593419-101593441 CCACATAGGTAGAATGAAGAAGG + Intergenic
995037546 5:107552220-107552242 CCATAAAGCTAGTATGTGGAAGG - Intronic
995484855 5:112629796-112629818 CTGGATAGGCATTATGTGGATGG - Intergenic
996028336 5:118676713-118676735 CCACTGAGGAAGTAAGTGGAGGG - Intergenic
997431671 5:133845124-133845146 TCACAGAGGCAGGGTGTGGATGG + Intergenic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
999426183 5:151489513-151489535 CCACAGAGGCAGTGTGGGGCCGG - Exonic
1000664557 5:163979221-163979243 ACACTTAAGCAGTCTGTGGATGG - Intergenic
1000758949 5:165197162-165197184 CCACACAGGAAGAATGCGGAGGG - Intergenic
1002523336 5:179803229-179803251 CCAGAGAGGCAGGGTGTGGAGGG - Intronic
1006583866 6:35092720-35092742 ACACAGAGGCAGAATGTGTAAGG - Intergenic
1006921769 6:37632287-37632309 CCACAAAGGCAGTGTTTGGTTGG + Exonic
1011700398 6:89950109-89950131 CCACAGAGGCAGGATGCTGAAGG - Intronic
1011752619 6:90468554-90468576 CCACATATGGGGTATGGGGAAGG - Intergenic
1013550731 6:111205287-111205309 CCACATGGGCACTATATGGGTGG + Intronic
1016930410 6:149401342-149401364 ACACATAGGCAGAAAGTGAAGGG + Intronic
1020600248 7:10266361-10266383 CCAAATAGGCATGATGTGCATGG - Intergenic
1020819053 7:12943030-12943052 CCACAAAGACAGTGGGTGGATGG - Intergenic
1023463385 7:40425792-40425814 CCAGAAAGGCAGTATCTGGTGGG + Intronic
1024233416 7:47379997-47380019 CCAGAGAGGCAGTGTGTGGCTGG - Intronic
1025250940 7:57350986-57351008 TAACATAGGCAGTGTGTGGAGGG + Intergenic
1029606135 7:101600585-101600607 ACACATAGGCAGGAAGTGGCAGG - Intergenic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1034281707 7:149859239-149859261 CCAAAGAGGCAGTAAGGGGAGGG - Intronic
1034610764 7:152366366-152366388 CCACATTGGCAGTATGTCTATGG + Intronic
1036603832 8:10288756-10288778 TCACATAGGAAGGATGTGGCAGG - Intronic
1036637227 8:10559672-10559694 CCAGATAGGCAGTACTTTGATGG - Intergenic
1037872085 8:22507812-22507834 TCCCATAGCTAGTATGTGGAGGG + Intronic
1038402980 8:27299542-27299564 GCACACAGCTAGTATGTGGAAGG + Intronic
1039219682 8:35315777-35315799 TCACATAGCCAGTAAGTGGCAGG + Intronic
1041853593 8:62421884-62421906 TCATATAGTCAGTATGTGGTGGG + Intronic
1043426436 8:80152851-80152873 CCACATAGGCTGTCTTTGGCAGG - Intronic
1044917549 8:97131616-97131638 CCCCAGAGGCATTTTGTGGAGGG + Intronic
1045780535 8:105857666-105857688 ACACATAGGCAGAAAGTGAAGGG + Intergenic
1046198843 8:110894962-110894984 CCACAAAGACAATATGTGTAAGG - Intergenic
1046726386 8:117679007-117679029 CCCCATAGAAAGTAAGTGGAGGG - Intergenic
1050649567 9:7760736-7760758 CTACATCTGTAGTATGTGGAAGG + Intergenic
1050953024 9:11621158-11621180 GGAAATAGGCAGTAGGTGGAAGG - Intergenic
1054796745 9:69309247-69309269 CCACATAGGCAGCTAGTGGCAGG + Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1203741746 Un_GL000218v1:9569-9591 ACACTTAAGCAGTCTGTGGATGG - Intergenic
1191725322 X:64273733-64273755 ACACATAGGCTGAAAGTGGAGGG + Intronic
1199974373 X:152884315-152884337 TCACCTAGGCAGTATGGGAATGG - Intergenic