ID: 909021959

View in Genome Browser
Species Human (GRCh38)
Location 1:70441392-70441414
Sequence GAGTTGCTTTGGCCTCTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909021959 Original CRISPR GAGTTGCTTTGGCCTCTAGA TGG Intergenic
900978194 1:6030381-6030403 GACTTGCTTTGGCCACCGGAAGG - Intronic
902704807 1:18197268-18197290 GAGGTGCTGTGGCCCCCAGATGG + Intronic
902928398 1:19713115-19713137 GACTTGCATTGGCCCATAGAAGG - Intronic
909021959 1:70441392-70441414 GAGTTGCTTTGGCCTCTAGATGG + Intergenic
913490971 1:119379712-119379734 GAAGTGCATTGGGCTCTAGATGG - Intronic
919969963 1:202569495-202569517 CAGTATCTTTGCCCTCTAGAGGG + Intronic
921033415 1:211353805-211353827 GAGGTGCTGTGGCACCTAGAAGG + Intronic
922577550 1:226672660-226672682 GAGATCCTTAGGCCTTTAGAGGG - Intronic
923884342 1:238138407-238138429 GAGTTGCTTTAGCCTCTAAAAGG + Intergenic
924637766 1:245804752-245804774 TTGTTGCTGTGGCCTCCAGAGGG - Intronic
1063933885 10:11057257-11057279 GCGATGCCTGGGCCTCTAGAGGG + Intronic
1066633413 10:37478679-37478701 GACTTGCTCAGGCCTCTGGAGGG + Intergenic
1069010864 10:63369975-63369997 GTGTAGCTTTGGCCTCTGGGAGG - Intronic
1079428043 11:20362903-20362925 GTGTTTCATTGGCTTCTAGATGG + Intergenic
1080177367 11:29381315-29381337 GAATTGCTTTGGCCTGTGGAGGG + Intergenic
1084249454 11:67885627-67885649 TAGATCCTGTGGCCTCTAGATGG - Intergenic
1084768386 11:71326892-71326914 GAGTTGCATGGGCCCCAAGAGGG - Intergenic
1086047902 11:82554178-82554200 GAGTGGCTTTGGCCTCAATCAGG - Intergenic
1089374416 11:117984455-117984477 GAGTTGCTTTAGCCTCCATAAGG - Intergenic
1092388154 12:8051516-8051538 GTGTGGCTTTGGAATCTAGATGG + Intronic
1092520516 12:9267739-9267761 GGTTTTCTTTGGGCTCTAGAAGG + Intergenic
1093352725 12:18123806-18123828 GAGTTGCTTCGTCATCTTGAAGG + Intronic
1093628311 12:21378419-21378441 GAGTTACATTGTCCTCTAAAGGG - Exonic
1095272494 12:40236352-40236374 AAGTTGCTTTGGCCACTAAGAGG + Intronic
1095655764 12:44667979-44668001 TAGTTGCTTTGGTCTCAGGAGGG - Intronic
1096335294 12:50750748-50750770 GTGTTGCTGTGTCCTCCAGAGGG - Intergenic
1098429260 12:70401908-70401930 GACTTGCTTTGACCAATAGAAGG - Intronic
1101526973 12:105539673-105539695 GACTTGATTTGGCCAGTAGAAGG + Intergenic
1103983846 12:124754391-124754413 GACTTGCTTTGGCCATAAGAAGG - Intergenic
1105968565 13:25406489-25406511 GAGTTGCTTTTGCTTCCACATGG + Intronic
1109296038 13:60531662-60531684 GAGTTGCTTTTGACTCTGTAAGG - Intronic
1113968091 13:114166019-114166041 GAACTGCCTTGGCCTTTAGAAGG - Intergenic
1118090361 14:62469066-62469088 GGGTTCCTTTGGCAGCTAGATGG - Intergenic
1120032930 14:79663163-79663185 GAGTTTCATTGGCCTCTACTGGG + Intronic
1120722065 14:87900436-87900458 GAATTGATGGGGCCTCTAGATGG - Intronic
1121901035 14:97693706-97693728 GAGATGCTTTTGCCTCTCAAGGG + Intergenic
1122384809 14:101337114-101337136 GAGTTGCTGTGGCCGGAAGAAGG + Intergenic
1122419779 14:101568098-101568120 GAGTTGTTTTAGCCTCTGCAAGG - Intergenic
1122968831 14:105144213-105144235 GGGTTGCTGTGGCCTCGTGAAGG - Intronic
1124254929 15:28132543-28132565 AAAATGCTTTGGCTTCTAGAAGG - Intronic
1125399498 15:39285447-39285469 GAGTTGCTCTGGAGTATAGATGG - Intergenic
1126168257 15:45672155-45672177 GATTTGCTTTGGGAACTAGAAGG + Intronic
1129668816 15:77595619-77595641 TGGTGGCTTTGGCCTCTAGAAGG - Intergenic
1134486891 16:14665804-14665826 GAGTTGCTTTGGCCTCCACAGGG + Intronic
1134860881 16:17559432-17559454 CAGTTGCTGTGGCCTCAAAAGGG + Intergenic
1135822299 16:25694737-25694759 GAGTAGCTTTGGCCTTATGAGGG + Intronic
1137972948 16:53003642-53003664 TAGCTGTTTTGCCCTCTAGAAGG + Intergenic
1137973053 16:53004817-53004839 CAGCTGTTTTGCCCTCTAGAAGG + Intergenic
1138077298 16:54055329-54055351 GAGCTGGTTTAGCCTCTGGAAGG + Intronic
1138411895 16:56846968-56846990 GAGGTTCTTTGACCTGTAGATGG + Intronic
1139291294 16:65860365-65860387 GAATTACTTTGGCCTCCACATGG - Intergenic
1142155604 16:88531707-88531729 GAGATGCTTTGGCCTCATGGGGG - Intronic
1143809542 17:9459894-9459916 AAGTTTTTTTGGCATCTAGAAGG + Intronic
1146695490 17:34906316-34906338 AAGTTGCTTTGGCTTTTGGAAGG - Intergenic
1147202967 17:38816009-38816031 GACTTAATTTGGCCCCTAGATGG - Intronic
1149467827 17:56893578-56893600 GATTGGCTTTGGCCTCCACATGG + Intronic
1150798070 17:68255380-68255402 GAGTTCTGTTGGCCTCTAGTGGG + Intronic
1151612403 17:75184803-75184825 TAATTTCTTTGGCCTCTGGATGG + Intergenic
1152543268 17:80987787-80987809 GATTTGCTGTGGCCTCTGGTTGG + Intergenic
1154198367 18:12282297-12282319 CACTTGCTTTGGCCTCCAGAAGG + Intergenic
1155580382 18:27298613-27298635 TAGTTCCTTTGTACTCTAGATGG - Intergenic
1159814762 18:73059150-73059172 GAGTGGCTTGGGCCTCCAGGGGG + Intergenic
1162102454 19:8347889-8347911 GGGTGTTTTTGGCCTCTAGAGGG + Intronic
1163125900 19:15244111-15244133 CAGCTGCTCTGGTCTCTAGAGGG - Intronic
1165867506 19:38947958-38947980 GAGTCGCTTTTGCCTCCACAAGG - Intronic
1166656902 19:44618813-44618835 GACTTGCTTTGACCAATAGAAGG - Intronic
1167003134 19:46757463-46757485 GGGTTGCTTCCGCCACTAGAGGG + Exonic
925219216 2:2124166-2124188 CAGTTTCTTTGGCCTGAAGAGGG + Intronic
927378834 2:22453458-22453480 GACTTGCTTTGGCCAATAGAAGG - Intergenic
927666387 2:25035832-25035854 GAGTTGCCTTGGGCTGTAGGAGG - Intergenic
928094425 2:28394898-28394920 CGGTGGCCTTGGCCTCTAGAAGG + Intronic
928234748 2:29529869-29529891 GAGCTGCTCTGTCCTCTGGAGGG - Intronic
930272232 2:49270290-49270312 TCTCTGCTTTGGCCTCTAGAGGG + Intergenic
934033489 2:88068187-88068209 GATTTGCTGTGGCTCCTAGAAGG + Intronic
937639954 2:124200914-124200936 GAGGTGATTTGGCCTGAAGATGG - Intronic
937730695 2:125225011-125225033 AAGTGGCTCTGGCCTCAAGATGG + Intergenic
939883561 2:147657031-147657053 GACTTGCTTTGCCCAATAGATGG + Intergenic
947257110 2:228179731-228179753 GAGTTGCTTTGCTCTTTATAAGG + Intronic
1169346200 20:4829800-4829822 GGCTTGCTTTGGCCAATAGAAGG + Intergenic
1170118902 20:12891552-12891574 GACTTGCTTTGGCCAATGGAAGG - Intergenic
1170277270 20:14605321-14605343 GAGTTCCTTTGGCTCGTAGATGG + Intronic
1170354598 20:15478356-15478378 GACTTTCTCTGGCCCCTAGAGGG - Intronic
1170774861 20:19366321-19366343 TAGTTGCTTTCACTTCTAGAAGG - Intronic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1173331124 20:42077248-42077270 GGGGTCCTTGGGCCTCTAGAAGG - Exonic
1174429230 20:50455970-50455992 GAATTGCGTTGGGCTCCAGATGG + Intergenic
1177247198 21:18543290-18543312 GAGTTGCTTTAGCCTCCACAAGG - Intergenic
1181944462 22:26505227-26505249 GAGAGGCTTTGGTCTCAAGAAGG + Intronic
1183285984 22:36964315-36964337 GACTTCCTTTGGCCAGTAGAAGG + Intergenic
950023382 3:9804675-9804697 GAGTGGCTGTGATCTCTAGACGG + Intronic
952109819 3:30109407-30109429 GAGTGGCTTTGGACTCCAGCAGG - Intergenic
953309056 3:41859274-41859296 GAGGTGATTTTGCATCTAGAAGG + Intronic
953415022 3:42710758-42710780 GAGTGGCTCTGCCCTCTACAGGG + Intronic
957216026 3:77320482-77320504 GATTTCCTTTTGCCTCTAGAGGG + Intronic
961223749 3:125220493-125220515 CAGTTTCTCTAGCCTCTAGACGG - Intergenic
961289676 3:125835790-125835812 TAGATCCTGTGGCCTCTAGATGG + Intergenic
962760789 3:138511413-138511435 AAGCTGATATGGCCTCTAGAAGG + Intronic
964952221 3:162309941-162309963 GAATTGCTTTCACCTCTTGATGG - Intergenic
966345841 3:178978713-178978735 GAATTGCTTTGGCCTCTACTGGG + Intergenic
969007595 4:4033783-4033805 TAGATCCTGTGGCCTCTAGATGG - Intergenic
969746014 4:9072280-9072302 TAGATCCTGTGGCCTCTAGATGG + Intergenic
969805376 4:9603710-9603732 TAGATCCTGTGGCCTCTAGATGG + Intergenic
970162440 4:13202556-13202578 GTGATGCTTTTGCCTCTAGCGGG - Intergenic
970701986 4:18752368-18752390 GAGTTGCTTTGGTCTTAACAAGG + Intergenic
973588004 4:52411489-52411511 GAGTTGATGTGCCCTTTAGATGG + Intergenic
976091810 4:81466179-81466201 AAGTTTCTCTGGCATCTAGATGG - Intronic
978978421 4:114910623-114910645 GAGATGTATTGGCATCTAGATGG - Intronic
980842510 4:138281875-138281897 GATTTGCCTTGGCATCTAGTAGG - Intergenic
983170051 4:164525612-164525634 GAGTTGCTTTGGCCTCCACATGG - Intergenic
985778909 5:1859445-1859467 ACGTTGCCTTGGTCTCTAGAAGG - Intergenic
986175979 5:5352074-5352096 GGGTTGGATTGGCCTCTGGAGGG + Intergenic
987944368 5:24585353-24585375 TTGCTTCTTTGGCCTCTAGAAGG + Intronic
992407755 5:76475865-76475887 GATTTCCTTTGGCCTCTGCATGG + Intronic
994164604 5:96595680-96595702 TACTTTCTTTGGCCTCTAGGTGG - Intronic
996688885 5:126316272-126316294 GATTTGCTTTGGCCTGAAGAAGG + Intergenic
999740104 5:154543375-154543397 GATTTGCTTTGGCCAATAGAAGG + Intergenic
999978638 5:156937495-156937517 GAGATGTTTTGGCCTACAGAGGG + Intronic
1000955925 5:167543316-167543338 GATTTGCTTTGACCAATAGAAGG - Intronic
1001423570 5:171606614-171606636 TAGTAGCTTTGTCCACTAGAGGG - Intergenic
1001614835 5:173034416-173034438 GAGGTGATTTTGCATCTAGAAGG - Exonic
1002402900 5:179001810-179001832 GTGTTGCTGTGGCCTCCAGCTGG - Intergenic
1010759325 6:79704429-79704451 GAGCTCCTCTGGGCTCTAGAAGG + Intergenic
1014670995 6:124303669-124303691 GAGTTACTTTTGTCTCTACAGGG + Intronic
1017008709 6:150047234-150047256 GAGCTGCTTCAGGCTCTAGAAGG + Intergenic
1018112787 6:160551802-160551824 GAATTGCTTTGCCATCTATACGG + Intronic
1018768298 6:166951338-166951360 GAGATGGTTAGGCCTCCAGATGG + Intronic
1020328116 7:6991912-6991934 TAGATCCTGTGGCCTCTAGATGG - Intergenic
1021330322 7:19330157-19330179 GAGTTGTTTTTGCTTCTTGAAGG + Intergenic
1022685465 7:32592158-32592180 CAGTAGCTTTGGTTTCTAGATGG - Intergenic
1024447316 7:49496189-49496211 GAGAAGCTTTGGGCTCTGGAGGG - Intergenic
1026969362 7:74458568-74458590 GAGGGGCTTTGGCCTGTAGGGGG + Intronic
1029606613 7:101602875-101602897 GAGTCACTGTGGCCTCTTGAGGG - Intergenic
1032358316 7:131230484-131230506 AAGGTGCTTTGGCCCCTACAAGG - Intronic
1034092073 7:148372963-148372985 CATTTGCTTTGGCCTCCACAGGG + Intronic
1035985100 8:4420732-4420754 GCATTGGTTTGCCCTCTAGACGG - Intronic
1036368511 8:8142196-8142218 TAGATCCTGTGGCCTCTAGATGG + Intergenic
1036882376 8:12523446-12523468 TAGATCCTGTGGCCTCTAGATGG - Intergenic
1037047695 8:14328933-14328955 GTGTTGCTGTGTCCTCCAGAGGG - Intronic
1042337940 8:67648084-67648106 AAGTTCCTTTGGCCCCTATAGGG + Intronic
1044634389 8:94308137-94308159 GAGTTGCTTTGGAACCTAAAGGG + Intergenic
1044675712 8:94726784-94726806 GACTTGCTTTGGCCAATAAAAGG - Intronic
1045948952 8:107829976-107829998 GACTTGCTTTGGCCAACAGAAGG - Intergenic
1047173691 8:122520214-122520236 GAGTTGCTTCAGCCTTTAGATGG + Intergenic
1048700676 8:137085522-137085544 GATATTATTTGGCCTCTAGAAGG + Intergenic
1049633672 8:143673944-143673966 GAGCGGCTTTGGCCTCCACAAGG - Intergenic
1052718064 9:32142473-32142495 GAGTTGCTTTTCCCCCTAAATGG - Intergenic
1055498901 9:76883866-76883888 GACTTGCTTTGGCCAATGGATGG + Intronic
1056526916 9:87451941-87451963 GAGTTGCTTCAGCCTCCACAGGG + Intergenic
1056990544 9:91406304-91406326 GCGTTTCTTTGGTCTCTAGTGGG + Intergenic
1060438596 9:123617506-123617528 CAGTGGCTTGGGGCTCTAGAAGG - Intronic
1061594144 9:131618073-131618095 AAGTTGCTTCTGCCTCTTGATGG - Intronic
1186955521 X:14677733-14677755 GAGTTGCTCTGGTTTCTAGTGGG - Intronic
1189281798 X:39824302-39824324 GAGTGGGATTGGCCTTTAGATGG - Intergenic
1191867907 X:65720491-65720513 GACCTGCCTTGGCCTCAAGAGGG - Intronic
1192274625 X:69616440-69616462 GGGTTTCTTTGGCCTCTCGCTGG + Exonic
1192572368 X:72216998-72217020 GATGTGCTTTGGCATCTAGAGGG - Intronic
1196303682 X:114075267-114075289 GTATTGCATTGGCCACTAGATGG - Intergenic
1197871139 X:131063792-131063814 GACTTGCTTTTGTCTCTAGAGGG + Intronic