ID: 909021994

View in Genome Browser
Species Human (GRCh38)
Location 1:70441711-70441733
Sequence CTGAATATAGAAATGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 5, 2: 27, 3: 85, 4: 398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909021994_909021999 29 Left 909021994 1:70441711-70441733 CCACTGTCCATTTCTATATTCAG 0: 1
1: 5
2: 27
3: 85
4: 398
Right 909021999 1:70441763-70441785 AACTACCATCGTGTTAGTCAAGG 0: 1
1: 0
2: 1
3: 1
4: 60
909021994_909021998 -6 Left 909021994 1:70441711-70441733 CCACTGTCCATTTCTATATTCAG 0: 1
1: 5
2: 27
3: 85
4: 398
Right 909021998 1:70441728-70441750 ATTCAGTCTCTTAGGGCTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909021994 Original CRISPR CTGAATATAGAAATGGACAG TGG (reversed) Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902908398 1:19576616-19576638 CTCACTTTAGAAATGGCCAGTGG + Intergenic
903546731 1:24128795-24128817 ATGAATATGGAAGTGAACAGGGG - Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904406240 1:30290210-30290232 CTCAATGTAGGAATGCACAGTGG + Intergenic
904588787 1:31595859-31595881 CTGAATACAGAATGGGAAAGTGG - Intergenic
906473011 1:46146777-46146799 ATGAGTATAGAATTGGAGAGAGG - Intronic
907833056 1:58083467-58083489 CTGAATAATGGAATGGACAAAGG + Intronic
908121846 1:60993255-60993277 CTGAAAAAGGAAATGGGCAGGGG + Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
909675145 1:78231137-78231159 CTGAATATAGAAGCAGACATAGG + Intergenic
911565369 1:99457411-99457433 CTGAATGTAGTAATGGATTGAGG - Intergenic
911724651 1:101230293-101230315 GTGAATAAAAAAATGGAAAGTGG + Intergenic
912045399 1:105447843-105447865 CTGAATATGGAAAGGAAAAGTGG - Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912955102 1:114149915-114149937 CTGAAAGTAGAAATAAACAGGGG - Intronic
913237982 1:116801518-116801540 GTGGATATAGCAATGTACAGAGG - Intergenic
913260135 1:116990383-116990405 CTGAAGATATGAAAGGACAGAGG - Intergenic
913392227 1:118326873-118326895 CAGAAAATAGAAATGAACATTGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
916933322 1:169602258-169602280 TTCAATATAGAAGTGGAGAGAGG + Intronic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917648962 1:177057433-177057455 CAAAATATAGAAATAAACAGTGG + Intronic
918520191 1:185406762-185406784 CTAAATGCATAAATGGACAGGGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
919194077 1:194261084-194261106 CTGCATATTGAATTGGACATAGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
923504242 1:234591770-234591792 CTGAATATAGAAACAGAAGGAGG - Intergenic
923608247 1:235464968-235464990 CTGACTATGGAAATGTAAAGTGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924786926 1:247207486-247207508 CTGAATATGGCAATGGAAAGTGG + Intergenic
1063058524 10:2526926-2526948 CCGAATATAGGAAAGGACATTGG + Intergenic
1063917567 10:10899356-10899378 ATGAATATAGAAAATGAAAGAGG + Intergenic
1064165068 10:12978747-12978769 CAGAATAAGGAAATGGAAAGAGG + Intronic
1064770043 10:18713528-18713550 ATTAATATAAAAATGGAGAGTGG + Intergenic
1065798122 10:29325743-29325765 TTGAATAAAGAAAAGGAAAGAGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067185246 10:44021642-44021664 ATGAATTTAGAAAGGGACAGAGG - Intergenic
1068440307 10:57046152-57046174 CTGAATATAGAAATGGGAGTTGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG + Intronic
1069057991 10:63864856-63864878 CTGAAACTAGAAATGGGCAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069440168 10:68421286-68421308 CTGGGTTTACAAATGGACAGAGG - Intronic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070208935 10:74294632-74294654 CTGAAGATAGAAAATAACAGTGG - Intronic
1070237394 10:74643155-74643177 CTTAAAATTGAAAGGGACAGAGG + Intronic
1070274949 10:74997058-74997080 CCTAATAGAGAAATGGGCAGAGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1070933116 10:80274604-80274626 GTGAAGATGGAAATGGACAGCGG + Exonic
1071058744 10:81544579-81544601 CCCAATTTAGAAATGGACAAAGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071441639 10:85703290-85703312 CAAAATAAAGAAATGAACAGCGG + Intronic
1071764165 10:88643379-88643401 ATGAATATAGAAATTCAGAGAGG + Intergenic
1073901203 10:108223235-108223257 CTAAATGGAGAAATGGAAAGAGG + Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1079621724 11:22563909-22563931 CTGGACATAGGAATGGACAAAGG - Intergenic
1080337827 11:31219423-31219445 CTGAATATAAACATGAGCAGAGG + Intronic
1080954381 11:37075901-37075923 CTGCACATAGAAAAGTACAGTGG + Intergenic
1081056110 11:38412774-38412796 ATCATTGTAGAAATGGACAGTGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081102922 11:39027568-39027590 CTAAATACAGAAAGGTACAGTGG - Intergenic
1081422998 11:42894295-42894317 CTAAATATGCAAATGGACTGTGG - Intergenic
1081567748 11:44270325-44270347 CTGAAGATGGAAATGGTGAGAGG + Intronic
1081902424 11:46640316-46640338 CTGAATATACTAACAGACAGTGG - Intronic
1084455653 11:69266719-69266741 CTGAACAAAGAAATGTGCAGGGG - Intergenic
1085243410 11:75077238-75077260 CTGAAAAGTGAAATGGAAAGAGG - Intergenic
1085831384 11:79904960-79904982 CTGAATTTAGAGATGGGGAGAGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087456716 11:98395979-98396001 CAGAATATAGATATGGGCAAAGG + Intergenic
1087578613 11:100023885-100023907 CTGAATAGATAAATGAACTGTGG - Intronic
1087934405 11:104015800-104015822 ATGAAAATAGAAATGGAAAATGG - Intronic
1088008617 11:104972363-104972385 CTCAATACAGAAATGAAAAGCGG + Intergenic
1089016020 11:115166282-115166304 CTGAATATTCAAAGGCACAGAGG + Intergenic
1090813033 11:130264105-130264127 CTGAATATAGTAAGATACAGAGG - Intronic
1091890063 12:4046330-4046352 CTGGAAATAGAAATGGGCATGGG - Intergenic
1092048928 12:5454296-5454318 CTGAACACAGACATGCACAGAGG - Intronic
1092999843 12:13983848-13983870 CTGAATACAGAAAATGAGAGTGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095581367 12:43804210-43804232 CTGACATTAGAAATGGACTGTGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097759779 12:63449751-63449773 CTGAATATTGAAATGCATATGGG - Intergenic
1098910799 12:76206395-76206417 CTTAATATAGAAATGACAAGGGG - Intergenic
1099434446 12:82627022-82627044 CTGAATATAGCAATGGCAGGAGG + Intergenic
1101200908 12:102435375-102435397 CAGAATATAGAAGAGGACACAGG + Intronic
1101475411 12:105042129-105042151 CTAAATAAAGAAATGGATATAGG - Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1102999192 12:117372299-117372321 ATAAATAAAGAAATGGACATTGG - Intronic
1103608007 12:122102257-122102279 CCCAATTTAAAAATGGACAGAGG + Intronic
1103855606 12:123967895-123967917 ATGCATTTAGAAATGGACTGGGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1106381187 13:29241232-29241254 AAGAAAAGAGAAATGGACAGAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1106944509 13:34811735-34811757 CTCAATATACAAAGGGATAGGGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107678868 13:42826746-42826768 TTGAATATAGAAATTAACATGGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110709023 13:78629500-78629522 CTGAACAGAGACATGGAGAGAGG + Intronic
1110868830 13:80426365-80426387 ATGAATAAAGAGGTGGACAGAGG - Intergenic
1111695745 13:91621638-91621660 CTAAATATTGAAATGGTCACAGG - Intronic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112558377 13:100490066-100490088 CAGAATGCAGAAATAGACAGAGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112771345 13:102798512-102798534 CTGAATATAGAAATAGCGGGCGG + Exonic
1112936414 13:104805275-104805297 ATGAATATAGAAATGGAAATTGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1113969601 13:114178708-114178730 CTGATTAGAGCAATGGAGAGAGG + Intergenic
1114377512 14:22164089-22164111 CTGAAAGTAGAAAAGGAGAGTGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114874382 14:26697638-26697660 CTGGATAGAGAAATTGCCAGAGG + Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116486380 14:45453540-45453562 TTGAACAGAGAAATGAACAGAGG - Intergenic
1116516170 14:45808889-45808911 CTGAATTAATTAATGGACAGTGG + Intergenic
1122137441 14:99642880-99642902 CTGAATATTGACAAGGACATTGG - Intergenic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1122456354 14:101855299-101855321 CTGAATGCAGAAGCGGACAGGGG - Intronic
1126460833 15:48913460-48913482 CTCCATCTAGAAATGGACTGGGG - Intronic
1127010377 15:54619662-54619684 CTGAAATTTGAAATGGTCAGAGG + Intronic
1128209227 15:65882168-65882190 GTGAATATAGAAAGGAAAAGTGG - Intronic
1128571109 15:68733494-68733516 ATGTATATATAAATGGCCAGAGG + Intergenic
1128908122 15:71486647-71486669 ATGTATATAGAGGTGGACAGAGG - Intronic
1129881773 15:79011390-79011412 CTGAACATAGGAAGGGACAGAGG + Intronic
1130260172 15:82348518-82348540 CTTAACATAGACATTGACAGTGG - Intronic
1130268559 15:82430915-82430937 CTTAACATAGACATTGACAGTGG + Intronic
1130281061 15:82520489-82520511 CTCAACATAGACATTGACAGTGG + Intergenic
1130472432 15:84236670-84236692 CTTAACATAGACATTGACAGTGG + Intronic
1130479923 15:84351241-84351263 CTTAACATAGACATTGACAGTGG + Intergenic
1130491847 15:84436888-84436910 CTTAACATAGACATTGACAGTGG - Intergenic
1130503461 15:84515928-84515950 CTTAACATAGACATTGACAGTGG - Intergenic
1130594729 15:85241306-85241328 CTCAACATAGACATTGACAGTGG + Intergenic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131228473 15:90643977-90643999 CAGAAGATAGAAATGGAATGAGG - Intronic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1131971835 15:97901300-97901322 CTGCATAAAGAAATGGAAATGGG - Intergenic
1132433826 15:101781167-101781189 CTTAACATAGACATTGACAGTGG - Intergenic
1133499165 16:6348924-6348946 CTGGGGATAGAGATGGACAGAGG + Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137517033 16:49154804-49154826 ATTAATTTAAAAATGGACAGAGG + Intergenic
1137553969 16:49458664-49458686 CTGAATAGTGAGAAGGACAGGGG + Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1139303860 16:65966991-65967013 GTGATGATAGAAATGGCCAGAGG - Intergenic
1142567131 17:847653-847675 CTTTATATAGAAACGGACTGTGG + Intronic
1142656444 17:1397732-1397754 CTCAATAAAGGAATGGACACAGG + Intronic
1143089890 17:4443797-4443819 CCCAATAGAAAAATGGACAGTGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1143816597 17:9521078-9521100 GTGAATATAAAGATGCACAGAGG + Intronic
1143916056 17:10293898-10293920 CTGAATGCAGAGATGGAAAGAGG + Intergenic
1143960702 17:10716048-10716070 CTGAATATTGATGTGGACATGGG - Intronic
1144520986 17:15952044-15952066 CTGAATTCTGAAAAGGACAGTGG + Intronic
1144895162 17:18525332-18525354 CTGAATATAGAATTTTACTGGGG + Exonic
1145137062 17:20418899-20418921 CTGAATATAGAATTTTACTGGGG - Intergenic
1147522262 17:41184926-41184948 CTGAGTATAAAAGTGGACATGGG - Exonic
1147868801 17:43572542-43572564 CTGAATGTGGTAATGGACTGGGG + Intronic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1149032559 17:52100551-52100573 CTGAACAGAGAAATGGGGAGAGG + Intronic
1149367210 17:55957655-55957677 TTGAAGATAGAACTAGACAGAGG + Intergenic
1150002538 17:61451087-61451109 CAGAATCTGGAAAGGGACAGAGG + Intergenic
1150379380 17:64708603-64708625 CCGAACATGGAAATGGACAGAGG + Intergenic
1151170605 17:72242546-72242568 CTGAGGATTGAAATGGTCAGAGG - Intergenic
1151483860 17:74386558-74386580 CTGACTCTACAAATGGCCAGCGG - Intergenic
1153357470 18:4153735-4153757 CTGATTCTAGAAAAAGACAGTGG - Intronic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1155066907 18:22276036-22276058 TTCAATCTAGAAGTGGACAGTGG - Intergenic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155793345 18:30001697-30001719 CTGAATTTACAAATGGATGGTGG - Intergenic
1156605593 18:38663453-38663475 ATAAATATAGAAAGTGACAGAGG + Intergenic
1156946517 18:42839749-42839771 ATGAACATACGAATGGACAGTGG + Intronic
1157051081 18:44165985-44166007 CTAAATATAGATATGGATATAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157517166 18:48318980-48319002 TTTAATAGAGAGATGGACAGAGG + Intronic
1157811252 18:50697775-50697797 CTGGAGATAGAAATGCTCAGGGG + Intronic
1158131758 18:54159790-54159812 ATGGATATTGAAATGGACAGTGG - Exonic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159817158 18:73089222-73089244 TTGAATATAGATATAGACATAGG - Intergenic
1160077099 18:75688280-75688302 CTTAATACAAAAATTGACAGTGG + Intergenic
1160224636 18:77002640-77002662 TTGAATATTGAGATGCACAGAGG + Intronic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1160888118 19:1361792-1361814 CTGACTATGGAACAGGACAGAGG - Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164434992 19:28221366-28221388 CTGGACATACAACTGGACAGTGG - Intergenic
1164938021 19:32230047-32230069 CTAAATATAGGAAGGAACAGGGG + Intergenic
1165803792 19:38568198-38568220 CTGAATGTAGCTCTGGACAGAGG - Intronic
1166579090 19:43877013-43877035 CGGAATAGAAAAAAGGACAGTGG + Intronic
925167309 2:1725272-1725294 CTATATATAGGAATGAACAGAGG + Intronic
925902739 2:8520033-8520055 AAGAATATAGAACTGGACATTGG - Intergenic
926875450 2:17471741-17471763 CTGAATATAAGAAGTGACAGTGG + Intergenic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927352048 2:22126954-22126976 CAGAAGAAAGAATTGGACAGTGG - Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928675928 2:33651265-33651287 TTGAATATAGAAAGGAAAAGTGG + Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929221763 2:39472014-39472036 ATGAATGAAGAAATGGTCAGAGG + Intergenic
929845693 2:45523492-45523514 CTAAAACTAGAAATGAACAGGGG + Intronic
930144405 2:47986570-47986592 CCCAATTTAGAAATGGACAAAGG - Intergenic
930394171 2:50799147-50799169 CGGCATATATAAATGAACAGAGG - Intronic
930931108 2:56885251-56885273 CTAGATATAGAAGTGGACAATGG + Intergenic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
931696130 2:64871914-64871936 CTTAATATCAAAATGGGCAGGGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933523572 2:83406858-83406880 CTAAATAAAGAAATGAAGAGTGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936751176 2:115644043-115644065 CTGGATTTAGAAATGTTCAGTGG - Intronic
936978996 2:118246706-118246728 CTTGCTTTAGAAATGGACAGAGG - Intergenic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938807828 2:134823026-134823048 CTAAATATAGAAAGGGCCAGAGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939088083 2:137745595-137745617 CAGAACACAGAAATGGACAGAGG + Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939369777 2:141284104-141284126 TTGAAAATAAAAATGCACAGTGG + Intronic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941288331 2:163643355-163643377 CACAATATACAAATGTACAGGGG + Intronic
943978779 2:194519191-194519213 TTGAATAGATAAATGCACAGAGG - Intergenic
945384928 2:209186237-209186259 CTCAATAAAGAAATGGTCAAAGG + Intergenic
945386954 2:209212644-209212666 ATGAACATAGCAATGGAAAGAGG + Intergenic
945399977 2:209369686-209369708 CTTAATGTAGAAATGGATAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945884245 2:215358091-215358113 GTGAATAAAGAAATGATCAGGGG - Intergenic
946437618 2:219668355-219668377 CTGAATATAAAAATGCCCAGAGG - Intergenic
946469805 2:219947965-219947987 CTGGATATAGAGATGGATTGTGG + Intergenic
947153086 2:227134208-227134230 CTGAATGTAGTAATGGGGAGAGG - Intronic
1169054235 20:2607145-2607167 CTTTATATAAAAATGAACAGTGG - Intronic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169386010 20:5150250-5150272 CTGTTTCTAGAAATGGACACAGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172460112 20:35111323-35111345 CTGAATAATGAAGTGGACTGTGG + Intergenic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181101114 22:20539894-20539916 CCCAATTTAAAAATGGACAGAGG - Intronic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181507682 22:23371423-23371445 ATGAGAAGAGAAATGGACAGAGG - Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182309603 22:29395207-29395229 ATGTATATAGAAAGGCACAGCGG - Intronic
1183402505 22:37612942-37612964 CTGAATCCAGAAATGGATAGTGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952685181 3:36139408-36139430 TTGAATATAGAAAGGGAAAATGG + Intergenic
953034195 3:39197591-39197613 CTCAATATAGAAGTGGTGAGAGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
955047385 3:55372913-55372935 CAGAAGACAGAAATGGGCAGGGG - Intergenic
955646952 3:61150039-61150061 TTGAATGAAGAAAAGGACAGGGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956010349 3:64824213-64824235 CGGAATATAAAGATGAACAGGGG + Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957248765 3:77746117-77746139 CAGAATATCAAAATGGACACTGG - Intergenic
957380492 3:79421964-79421986 GTGGATATAAAAATGTACAGTGG - Intronic
957993943 3:87664137-87664159 CATTATATAGAAATGGTCAGAGG + Intergenic
958651647 3:96943506-96943528 CAGAATATTGAAATGCACTGGGG + Intronic
959504198 3:107139955-107139977 AGGAAAAAAGAAATGGACAGTGG - Intergenic
960279126 3:115761502-115761524 CTGAATAATGAAATGCTCAGAGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
962254819 3:133863181-133863203 CTGACCATAGGAATTGACAGAGG - Intronic
962368694 3:134803309-134803331 ATGAACAGAGAAATGGGCAGAGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
964860551 3:161196700-161196722 CTGCAGATAAAAATGGGCAGAGG - Intronic
965082940 3:164058789-164058811 CTGAACATAGTAATAGCCAGAGG + Intergenic
965094725 3:164210439-164210461 CTGGTTACAGAAATGGACGGTGG - Intergenic
965133254 3:164728201-164728223 CTGAATATTGACCTGGATAGTGG - Intergenic
965396629 3:168166911-168166933 CTAAATGTAGAAATGGAGAGTGG + Intergenic
965911373 3:173781609-173781631 TTGAATAGAGACATGGACACTGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966562454 3:181338257-181338279 CTGAATGTAGAAATGGTTTGTGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968537519 4:1143834-1143856 CTGAATATATAAAGGAACACGGG + Intergenic
968544029 4:1186693-1186715 CTCAATTTAAAAATGGGCAGAGG + Intronic
968867957 4:3225770-3225792 CTGAGGACAGAAACGGACAGAGG - Intronic
970010899 4:11457970-11457992 CTGAACACAGACATGTACAGAGG - Intergenic
970139257 4:12962723-12962745 CTCAAAAGAGAAATGGAGAGGGG - Intergenic
970420311 4:15899620-15899642 CTGAATTAAGAAGTGGACACTGG - Intergenic
971146163 4:23978981-23979003 TTGCATATAGAAAGAGACAGGGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971652909 4:29302671-29302693 CTTAATGCAGAACTGGACAGTGG + Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973832944 4:54780161-54780183 CTGAGTATGGAAAAGGACAATGG - Intergenic
976816124 4:89149639-89149661 TTGGACATAGACATGGACAGAGG + Intergenic
976971796 4:91112760-91112782 CTGAAGATGGAAGAGGACAGAGG - Intronic
977029857 4:91868590-91868612 CTGAAAATAGAATTTGATAGAGG + Intergenic
977880640 4:102200913-102200935 TGGAATATAGAAAAGGAGAGGGG - Intergenic
979155653 4:117386249-117386271 CTGAATTTAGAAAGAGACTGTGG + Intergenic
980141031 4:128917474-128917496 CTGGAAATTGAAATGGACTGTGG - Intronic
980192212 4:129539450-129539472 GACAATATAGAAATGGACACGGG + Intergenic
980762298 4:137251594-137251616 GGACATATAGAAATGGACAGGGG + Intergenic
980870447 4:138605453-138605475 CTATATATAGGAATGAACAGAGG - Intergenic
981301834 4:143195831-143195853 CTGAAAATAGAACTGGTAAGTGG + Exonic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981807970 4:148738867-148738889 ATTAATATAGAAGTGGAGAGAGG + Intergenic
982038335 4:151369617-151369639 CTGAATATGGAAAAATACAGAGG + Intergenic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
982398795 4:154943009-154943031 GTTAATGTAGAAATGGAAAGTGG + Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984330365 4:178307586-178307608 ATGAATAGATAAATGGAAAGAGG + Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
985628298 5:1001547-1001569 CTGGGTAGAGGAATGGACAGGGG + Intergenic
986211577 5:5678481-5678503 GTGAAGAGAGAAATGGACACAGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987665466 5:20932771-20932793 CTGAATATAACAAAAGACAGAGG + Intergenic
987943744 5:24576677-24576699 CTAAATAAATAAATGAACAGGGG + Intronic
988757226 5:34269407-34269429 CTGAATATAACAAAAGACAGAGG - Intergenic
989064919 5:37450567-37450589 CTGAATAAGTAAATGGATAGTGG - Intronic
990934910 5:61137814-61137836 AAGAAAATAGGAATGGACAGAGG + Intronic
991025507 5:62025398-62025420 CTAAATATGGAAATGGAAACTGG - Intergenic
991171904 5:63637238-63637260 ATGAATATGGAAATGCACACTGG - Intergenic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
993366806 5:87043592-87043614 CTGAAAAGAAAAATGAACAGAGG - Intergenic
993514364 5:88812296-88812318 ATGAATAGATATATGGACAGAGG + Intronic
994348670 5:98718857-98718879 CAGAATATAGGCATGGACAAAGG + Intergenic
995123898 5:108561218-108561240 ATGAATCTAGTAATGGTCAGGGG - Intergenic
996647199 5:125830256-125830278 ATGAAAATAGAAAGGGACAAGGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
998106824 5:139474024-139474046 CAGAATATAAAAAGGAACAGAGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000898143 5:166881116-166881138 CTGAAAATGGAAAAGGACAAAGG - Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003801744 6:9678006-9678028 CTGCCTCTAGAAATGGTCAGGGG - Intronic
1003911660 6:10748924-10748946 CTGATTATAGAGCTGGTCAGTGG + Intronic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006214245 6:32426125-32426147 CTGGATATAGAAACAGACAATGG + Intergenic
1007158636 6:39770880-39770902 CTGAACATAGAAATTGAGAGTGG - Intergenic
1007278023 6:40689943-40689965 CTTAATAAAGTAATGGAAAGGGG - Intergenic
1008415194 6:51231651-51231673 CAGAATATATAAAAGCACAGAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009742479 6:67764818-67764840 CTCAACATAGAAATAGAAAGTGG + Intergenic
1010380709 6:75221263-75221285 CTGAATAAAAAAATAGTCAGCGG - Intergenic
1010859314 6:80887093-80887115 CTTAATATTGAAATGGAAACAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012119934 6:95354126-95354148 CTAAAAATGGAAATGGAAAGAGG + Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012775091 6:103487261-103487283 CTGAATATCCAAATGGGGAGAGG + Intergenic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013833000 6:114297095-114297117 CTTTATAGAGAGATGGACAGAGG + Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1016156165 6:140811148-140811170 ATGAAGAAAGAAATGAACAGAGG + Intergenic
1016554473 6:145320295-145320317 TTCAATAGAAAAATGGACAGTGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1016999931 6:149989624-149989646 GTGCCTAAAGAAATGGACAGGGG - Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018153346 6:160961425-160961447 CTGAGGATAGAAAGGGCCAGAGG - Intergenic
1018345794 6:162898003-162898025 GTGAATGTAGACATGGACAGGGG - Intronic
1018606374 6:165602075-165602097 GTGAAAACAGAAATGGACAGTGG - Intronic
1019773353 7:2897358-2897380 CTGAGTATAAAAATGGTCACTGG + Intergenic
1020441226 7:8218843-8218865 CCAAATGTAGAAATGGGCAGTGG - Intronic
1020937088 7:14480107-14480129 CAGAATAGAGAAAGGGAGAGAGG + Intronic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1022452129 7:30525385-30525407 CTTAACATAGACATTGACAGTGG - Intronic
1022592101 7:31673387-31673409 CTGAAAATAGAAACAGACAATGG - Intergenic
1022872705 7:34495999-34496021 CTGATTAGAAAAGTGGACAGGGG - Intergenic
1023313720 7:38913732-38913754 CTGAATATATAAAGGGGCACTGG - Intronic
1023665333 7:42517164-42517186 CTAACTATATAAATGAACAGTGG + Intergenic
1023913495 7:44571436-44571458 TTGAAGATAGAGATGGAAAGGGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026596837 7:71739921-71739943 CTGAATATAGACATTCACTGTGG - Intergenic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026788008 7:73313817-73313839 CTGGAGAAAGAAATGGACACTGG + Intronic
1027843120 7:83339388-83339410 CTGAATAAATAAATGGCCAGAGG - Intergenic
1028379400 7:90182051-90182073 CTGAATATATACAGTGACAGAGG + Intronic
1028624218 7:92859710-92859732 CTGAATATAAAAAGGCCCAGGGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028852339 7:95551627-95551649 CTGAAAATAGAAAAGCTCAGGGG + Intergenic
1029099550 7:98117362-98117384 TTGAATAAAGAAATAAACAGAGG - Intronic
1030650235 7:112109689-112109711 CTATATATAGAAATGGACTCTGG - Intronic
1030969193 7:116033515-116033537 AGGAATAAAGAAATTGACAGAGG - Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1032915960 7:136490314-136490336 CTGAATCTAGAAATGAACTATGG - Intergenic
1033556690 7:142494363-142494385 CTGAATCTTGGAATGGACAAAGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035114224 7:156509295-156509317 CTGACTGAATAAATGGACAGTGG - Intergenic
1035956763 8:4088891-4088913 CTGAATATAAAAATGAGTAGAGG - Intronic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1036713311 8:11097287-11097309 CTGAATGTAGAAGTGGTGAGTGG - Intronic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1038064457 8:23949206-23949228 TGGAATATAAAAATGGTCAGTGG + Intergenic
1038388985 8:27177197-27177219 CCAAATTTAGAAATGGACACAGG + Intergenic
1038518865 8:28211841-28211863 TTCAATAAAGCAATGGACAGTGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040570254 8:48602279-48602301 CTGAATATTGAAATGAACCGTGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041301180 8:56413410-56413432 TTGAATATAGAAATGCAAATTGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1043256199 8:78140022-78140044 CTCATTATAGAAATGTAGAGAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044377334 8:91491607-91491629 CGTAATATAGATATGGCCAGAGG - Intergenic
1044560409 8:93606662-93606684 CTGAACACAGAGATGGGCAGTGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044851854 8:96436495-96436517 CTCAATATAGACATAGACATAGG + Intergenic
1045084700 8:98670065-98670087 CTGTATATAAAAATGAATAGAGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046065102 8:109186907-109186929 CTGAATATAGAAACTGAGTGAGG + Intergenic
1047112867 8:121810096-121810118 CTGGAAATGGAAATGGACAAAGG + Intergenic
1047237578 8:123055682-123055704 CTGAATGCAGAGTTGGACAGAGG - Intronic
1047608515 8:126497928-126497950 CAAAACAAAGAAATGGACAGAGG + Intergenic
1047912596 8:129546564-129546586 CAGCATACAGAAAAGGACAGAGG + Intergenic
1048696521 8:137034630-137034652 TTGAAAATAGAAATGCACACAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051779328 9:20671886-20671908 CTGAATATGGAATTTGAAAGAGG - Intronic
1052034505 9:23665080-23665102 CTGAATATATATAGTGACAGGGG - Intergenic
1052244229 9:26314219-26314241 CTGAATATAGAAATGGTCTTGGG + Intergenic
1053182130 9:35981751-35981773 CTGAATTTGGAAATGGTCAAAGG - Intergenic
1053601644 9:39616948-39616970 CTGAATATTAAAACAGACAGTGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053859292 9:42370715-42370737 CTGAATATTAAAACAGACAGTGG + Intergenic
1054251891 9:62725498-62725520 CTGAATATTAAAACAGACAGTGG - Intergenic
1054566004 9:66759999-66760021 CTGAATATTAAAACAGACAGTGG - Intergenic
1055020543 9:71664558-71664580 CAGAATATAGAAACGGGGAGAGG + Intergenic
1057620408 9:96629654-96629676 CTGCATTTAAAAATGGAAAGAGG - Intergenic
1058649419 9:107160805-107160827 ATGAAAATAGAATTGGATAGCGG - Intergenic
1058713097 9:107698165-107698187 CTGAAAAAAGAAATGGAGAGAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059389844 9:113992207-113992229 CTGGATGTAGAAGTGGGCAGTGG + Intronic
1059767740 9:117399920-117399942 ATGAATACAGAAGTGGACAGTGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060848181 9:126853744-126853766 GTGAATATAGAAGTAGACACGGG - Intergenic
1060862620 9:126967356-126967378 CTGAAAAAAGAAAAGGACAGAGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1188793206 X:34430636-34430658 CTGATTATAGGAAAGAACAGAGG - Intergenic
1189684957 X:43554329-43554351 CAGTTTGTAGAAATGGACAGAGG - Intergenic
1190110147 X:47583995-47584017 CTGAATATAGCATGGGCCAGTGG + Intronic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193051835 X:77110517-77110539 AGGAATAAAGAAGTGGACAGTGG + Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193556839 X:82964221-82964243 CTGAATCAAAAAATGGGCAGAGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1195210481 X:102649595-102649617 CTGAATTAAGAAGTGGACACTGG - Intergenic
1195275961 X:103281021-103281043 CTGGACATAGAAATGGGCACAGG - Intergenic
1195477915 X:105308164-105308186 ATGAATATGGAAAGGGAAAGGGG - Intronic
1195660538 X:107373653-107373675 ATAGATATAGATATGGACAGAGG + Intergenic
1195745906 X:108117919-108117941 ATGAAAATAGAAATTGACAGGGG + Intronic
1195795331 X:108641570-108641592 CCAAATATAGAAGTGGAAAGTGG + Intronic
1196398555 X:115290688-115290710 CTGACTTTAGAAATGGAGAAGGG + Intronic
1196920431 X:120579862-120579884 CTGAATATAGAATTCTACATTGG - Intergenic
1197539505 X:127739724-127739746 ATGAATATATAAATAAACAGTGG + Intergenic
1197841593 X:130753535-130753557 ATAAAGATAGGAATGGACAGAGG - Intronic
1198527479 X:137516358-137516380 CTCAGGATTGAAATGGACAGAGG + Intergenic
1199964258 X:152806660-152806682 CTGGACCTAGAAATGAACAGTGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201579477 Y:15495690-15495712 CTGAATACAGCATTGGAAAGTGG + Intergenic