ID: 909022471

View in Genome Browser
Species Human (GRCh38)
Location 1:70447529-70447551
Sequence CTTACTATTTCGTAAGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909022470_909022471 -3 Left 909022470 1:70447509-70447531 CCAATTTTTCTGTTTTAGCTCTT No data
Right 909022471 1:70447529-70447551 CTTACTATTTCGTAAGTACCTGG No data
909022468_909022471 26 Left 909022468 1:70447480-70447502 CCATTGCAGATATCTAGTAATAA No data
Right 909022471 1:70447529-70447551 CTTACTATTTCGTAAGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909022471 Original CRISPR CTTACTATTTCGTAAGTACC TGG Intergenic
No off target data available for this crispr